>NIGA_00010 asparagine synthase
ATGTGCGGATTTTTAGCGATCGACTCCAAAGAATTTGACTTGAAGACCTTTGACGAAGCCCTGGCCAAATGCCAGGATCGGGGACCGGACATGACCAGGGTCTTTGACGAGCGGGGAGTTACTTTTGGCTTCAACCGCTTGGCCATCATGGACTTGACGGACAGCGGGATGCAGCCCTTTGAAACCCTGGACTGCACCCTGGTCTGCAACGGGGAAATCTACAACTACCCGGAACTGAAAAAGAACCTGGAAACCGACTACGAATTTACTTCCAGCAGTGACTGTGAAGTTCTGATCCCCCTTTACCGCAAATACGGGATTGAGACGATGGTTAAGATGCTGGATGGGGAATTTTCCTTTGTCCTCTATGATCACCTCTCAAAGACGATTTACGCGGCTAGAGACATCATCGGTATCCGGCCAATGTTCTACGGCTTTACTAAAAAAGACGGCAAGATTGCTTTTGCCTCAACTGGCAAGAACCTGCTTGACCTCTGCCGCGAAATCCACCCCTTCCTGCCTGGCCACTACTATGACGGGGAAAAGATCGTGGCCTACCATGAACCAGACCTCACCCCCAAGATGAGTACTGACGATTTTGAGACTGCGACTCACAAGATTCATGACCTTCTGGTTGAATCAGTTGACCAGCGCCTGGCCTCAGACGCCCCGGTCGGCTACCTCCTTTCAGGCGGCCTTGACTCTTCCCTGGTCTGCTCGATCGCCGCCCGCCTGCAGCCAGATACAAAGATCAGAACTTTTGCCATTGGGATGGACCAAAACCCGATCGACCTTAAATATGCCCGGGAAGTGGCTGACTACCTGGGAACTGACCACACCGAGTTCATCATGACCAGAGAAGACGTGTTGGGTGTTTTAAGAGAAGTCATCTATACTTTGGAAACCTGGGACATCACGACTATCCGGGCTTCAATCGGGATGTACATTCTCTGCAAGAAGATCCATGAAACAACTGACTTGAAGGTCATCTTGACTGGTGAATGCTCTGATGAGCTATTTGGCTACAAATACACCGACTTCGCTCCAAGCCCGGAAGAATTCCAAAAAGAAGCAGCCAAGCGGCTCAGAGAGCTCTACATGTACGACGTCTTGCGGGCAGACCGCTGCATTTCCGCCAACTCTTTGGAAGGCAGAGTGCCTTTCGCTGACCGGGAATTCGTCGACTACGTCATGAGCGTGGATCCGGACTTGAAGATGAACCACTACCACAAGGGCAAGTACTTGCTCCGGAAGGCCTTTGAAGAAGGCGACTGGCTGCCCCGCGACATCCTTATGCGGGAAAAAGCAGCCTTCAGCGACGCCGTGGGCCACTCCATGGTTGATGACCTTAAGGAATACGCTGAAAGCAAGTACAGCGATGAAGACCTTGCTAAAGCAGGCGAAAAGTACCCATACCGGACGCCATTTACCAAGGAATCACTTCTTTACCGGGATATTTTTGAAGAATTCTACCCTGGCAAGGCTGACTGGATCAAGGACTACTGGATGCCAAACAGAAGCTGGAAGAGCCTGGAAAGCGTCACCGACCCAAGTGCCCGGGTATTGAGCAACTACGGGGCTAGCGGTGAATAA
>NIGA_00020 oligopeptide ABC transporter substrate-binding protein

>NIGA_00030 hypothetical protein

>NIGA_00040 hypothetical protein

>NIGA_00050 hypothetical protein

>NIGA_00060 hypothetical protein

>NIGA_00070 phosphate ABC transporter substrate-binding protein

>NIGA_00080 phosphate ABC transporter permease protein

>NIGA_00090 phosphate ABC transporter permease protein

>NIGA_00100 phosphate ABC transporter ATP-binding protein

>NIGA_00110 phosphate uptake regulator

>NIGA_00120 two-component system response regulator

>NIGA_00130 two-component system sensor histidine kinase

>NIGA_00140 hypothetical protein

>NIGA_00150 NUDIX family hydrolase

>NIGA_00160 hypothetical protein

>NIGA_00170 hypothetical protein

>NIGA_00180 C4-dicarboxylate anaerobic carrier

>NIGA_00190 energy-coupling factor transporter ATP-binding protein

>NIGA_00200 energy-coupling factor transporter ATP-binding protein

>NIGA_00210 energy-coupling factor transporter transmembrane protein

>NIGA_00220 energy-coupling factor transporter substrate-binding protein

>NIGA_00230 hypothetical protein

>NIGA_00240 GGDEF family protein

>NIGA_00250 hypothetical protein

>NIGA_00260 haloacid dehalogenase

>NIGA_00270 hypothetical protein

>NIGA_00280 hypothetical protein

>NIGA_00290 hypothetical protein

>NIGA_00300 dihydroneopterin aldolase

>NIGA_00310 GTP cyclohydrolase I

>NIGA_00320 folylpolyglutamate synthase

>NIGA_00330 dihydropteroate synthase

>NIGA_00340 dihydroneopterin triphosphate pyrophosphatase

>NIGA_00350 hypothetical protein

>NIGA_00360 MerR family transcriptional regulator

>NIGA_00370 polar amino acid ABC transporter permease protein

>NIGA_00380 amino acid ABC transporter permease protein

>NIGA_00390 glutamine ABC transporter ATP-binding protein

>NIGA_00400 amino acid ABC transporter substrate-binding protein

>NIGA_00410 AraC family transcriptional regulator

>NIGA_00420 hypothetical protein

>NIGA_00430 hypothetical protein

>NIGA_00440 hypothetical protein

>NIGA_00450 glycerol-3-phosphate acyltransferase

>NIGA_00460 DNA topoisomerase IV subunit B

>NIGA_00470 DNA topoisomerase IV subunit A

>NIGA_00480 manganese-dependent inorganic pyrophosphatase

>NIGA_00490 isopentenyl-diphosphate delta-isomerase

>NIGA_00500 phosphomevalonate kinase

>NIGA_00510 diphosphomevalonate decarboxylase

>NIGA_00520 mevalonate kinase

>NIGA_00530 ATP-dependent helicase/nuclease subunit B

>NIGA_00540 ATP-dependent helicase/nuclease subunit A

>NIGA_00550 ATP-dependent helicase

>NIGA_00560 hypothetical protein

>NIGA_00570 DNA replication protein DnaD

>NIGA_00580 endonuclease III

>NIGA_00590 haloacid dehalogenase

>NIGA_00600 hypothetical protein

>NIGA_00610 hypothetical protein

>NIGA_00620 D-lactate dehydrogenase

>NIGA_00630 dipeptidyl aminopeptidase / acylaminoacyl-peptidase

>NIGA_00640 penicillin-binding protein 1A

>NIGA_00650 recombination protein RecU

>NIGA_00660 hypothetical protein

>NIGA_00670 cell division protein GpsB

>NIGA_00680 RNA methyltransferase

>NIGA_00690 3',5'-cyclic-nucleotide phosphodiesterase

>NIGA_00700 formate--tetrahydrofolate ligase

>NIGA_00710 lipoprotein signal peptidase

>NIGA_00720 ribosomal large subunit pseudouridine synthase D

>NIGA_00730 carbamoyl phosphate synthase small subunit

>NIGA_00740 carbamoyl phosphate synthase large subunit

>NIGA_00750 hypothetical protein

>NIGA_00760 hypothetical protein

>NIGA_00770 fibronectin-binding protein

>NIGA_00780 transposase

>NIGA_00790 hypothetical protein

>NIGA_00800 IS630 family transposase

>NIGA_00810 hypothetical protein

>NIGA_00820 DegV family protein

>NIGA_00830 hypothetical protein

>NIGA_00840 drug/metabolite transporter permease

>NIGA_00850 D-3-phosphoglycerate dehydrogenase

>NIGA_00860 phosphoserine aminotransferase

>NIGA_00870 phosphoglycerate mutase

>NIGA_00880 hypothetical protein

>NIGA_00890 nitroreductase

>NIGA_00900 aspartate carbamoyltransferase

>NIGA_00910 dihydroorotase

>NIGA_00920 tyrosine recombinase XerS

>NIGA_00930 glycerate kinase

>NIGA_00940 hypothetical protein

>NIGA_00950 hypothetical protein

>NIGA_00960 TPR repeat-containing protein

>NIGA_00970 hypothetical protein

>NIGA_00980 hypothetical protein

>NIGA_00990 hypothetical protein

>NIGA_01000 hypothetical protein

>NIGA_01010 hypothetical protein

>NIGA_01020 alcohol dehydrogenase

>NIGA_01030 4-carboxymuconolactone decarboxylase

>NIGA_01040 hypothetical protein

>NIGA_01050 hypothetical protein

>NIGA_01060 hypothetical protein

>NIGA_01070 hypothetical protein

>NIGA_01080 hypothetical protein

>NIGA_01090 phosphoglycolate phosphatase haloacid dehalogenase hydrolase

>NIGA_01100 acetyltransferase

>NIGA_01110 bacterial membrane protein YfhO

>NIGA_01120 hypothetical protein

>NIGA_01130 hypothetical protein

>NIGA_01140 hypothetical protein

>NIGA_01150 hypothetical protein

>NIGA_01160 hypothetical protein

>NIGA_01170 hypothetical protein

>NIGA_01180 phosphoglycerate mutase

>NIGA_01190 hypothetical protein

>NIGA_01200 hypothetical protein

>NIGA_01210 peptide ABC transporter substrate-binding protein

>NIGA_01220 methyltransferase

>NIGA_01230 carbamoyl phosphate synthase large subunit

>NIGA_01240 carbamoyl phosphate synthase small subunit

>NIGA_01250 hypothetical protein

>NIGA_01260 MATE family efflux transporter

>NIGA_01270 MerR family transcriptional regulator

>NIGA_01280 integrase

>NIGA_01290 GNAT family acetyltransferase

>NIGA_01300 ABC transporter ATP-binding protein

>NIGA_01310 multidrug ABC transporter permease protein

>NIGA_01320 hypothetical protein

>NIGA_01330 hypothetical protein

>NIGA_01340 arsenate reductase

>NIGA_01350 hypothetical protein

>NIGA_01360 antimicrobial peptide ABC transporter ATP-binding protein

>NIGA_01370 antimicrobial peptide ABC transporter permease protein

>NIGA_01380 hypothetical protein

>NIGA_01390 hypothetical protein

>NIGA_01400 hypothetical protein

>NIGA_01410 toxin-antitoxin system antitoxin component Xre domain protein

>NIGA_01420 hypothetical protein

>NIGA_01430 hypothetical protein

>NIGA_01440 hypothetical protein

>NIGA_01450 ribosomal-protein-serine acetyltransferase

>NIGA_01460 hypothetical protein

>NIGA_01470 peptidyl-prolyl cis-trans isomerase

>NIGA_01480 aspartate aminotransferase

>NIGA_01490 4-hydroxy-tetrahydrodipicolinate reductase

>NIGA_01500 N-acetylneuraminate lyase

>NIGA_01510 acetyldiaminopimelate deacetylase

>NIGA_01520 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase

>NIGA_01530 aspartate kinase

>NIGA_01540 diaminopimelate epimerase

>NIGA_01550 hypothetical protein

>NIGA_01560 hypothetical protein

>NIGA_01570 hypothetical protein

>NIGA_01580 glutathione reductase

>NIGA_01590 hypothetical protein

>NIGA_01600 hypothetical protein

>NIGA_01610 hypothetical protein

>NIGA_01620 phosphinothricin N-acetyltransferase

>NIGA_01630 flavoprotein

>NIGA_01640 hypothetical protein

>NIGA_01650 hypothetical protein

>NIGA_01660 membrane protein

>NIGA_01670 microcin C7 resistance MccF related protein

>NIGA_01680 23S rRNA methyltransferase

>NIGA_01690 hypothetical protein

>NIGA_01700 SAM-dependent methyltransferase

>NIGA_01710 hypothetical protein

>NIGA_01720 pyrrolidone-carboxylate peptidase

>NIGA_01730 putative membrane protein

>NIGA_01740 homoserine O-succinyltransferase

>NIGA_01750 lactaldehyde/glycolaldehyde dehydrogenase

>NIGA_01760 glycine betaine/carnitine/choline ABC transporter substrate-binding and permease protein

>NIGA_01770 glycine betaine/carnitine/choline ABC transporter ATP-binding protein

>NIGA_01780 Rrf2 family transcriptional regulator

>NIGA_01790 hypothetical protein

>NIGA_01800 protease

>NIGA_01810 cystathionine beta-lyase

>NIGA_01820 peptidase S8

>NIGA_01830 GNAT family acetyltransferase

>NIGA_01840 hypothetical protein

>NIGA_01850 alkaline phosphatase

>NIGA_01860 aspartate-ammonia ligase

>NIGA_01870 LacI family transcriptional regulator

>NIGA_01880 beta-galactosidase

>NIGA_01890 sugar transport protein

>NIGA_01900 hypothetical protein

>NIGA_01910 hypothetical protein

>NIGA_01920 integrase

>NIGA_01930 signal peptidase I

>NIGA_01940 hypothetical protein

>NIGA_01950 peptidase T

>NIGA_01960 Nif3-like dinuclear metal center hexameric protein

>NIGA_01970 SAM-dependent methyltransferase

>NIGA_01980 transposase

>NIGA_01990 DNA mismatch repair protein MutT

>NIGA_02000 hypothetical protein

>NIGA_02010 hypothetical protein

>NIGA_02020 hypothetical protein

>NIGA_02030 hypothetical protein

>NIGA_02040 restriction endonuclease

>NIGA_02050 DNA methylase

>NIGA_02060 hypothetical protein

>NIGA_02070 helicase

>NIGA_02080 hypothetical protein

>NIGA_02090 hypothetical protein

>NIGA_02100 hypothetical protein

>NIGA_02110 alpha/beta hydrolase

>NIGA_02120 hypothetical protein

>NIGA_02130 hypothetical protein

>NIGA_02140 lipase

>NIGA_02150 hypothetical protein

>NIGA_02160 hypothetical protein

>NIGA_02170 cellobiose-specific PTS system IIC component

>NIGA_02180 hypothetical protein

>NIGA_02190 cellobiose-specific PTS system IIA component

>NIGA_02200 cellobiose-specific PTS system IIB component

>NIGA_02210 6-phospho-beta-glucosidase

>NIGA_02220 RNA polymerase sigma factor RpoD

>NIGA_02230 RNA polymerase sigma factor RpoD

>NIGA_02240 RNA polymerase sigma factor RpoD

>NIGA_02250 DNA primase

>NIGA_02260 glycyl-tRNA synthetase beta chain

>NIGA_02270 glycyl-tRNA synthetase alpha chain

>NIGA_02280 DNA repair protein RecO

>NIGA_02290 GTP-binding protein Era

>NIGA_02300 cytidine deaminase

>NIGA_02310 16S rRNA maturation RNase YbeY

>NIGA_02320 phosphate starvation protein PhoH

>NIGA_02330 30S ribosomal protein S21

>NIGA_02340 phosphotransferase

>NIGA_02350 hypothetical protein

>NIGA_02360 YitT family membrane protein

>NIGA_02370 hypothetical protein

>NIGA_02380 aspartate aminotransferase

>NIGA_02390 diaminopimelate decarboxylase

>NIGA_02400 hypothetical protein

>NIGA_02410 hypothetical protein

>NIGA_02420 hypothetical protein

>NIGA_02430 aldose 1-epimerase

>NIGA_02440 ATP-dependent protease ATPase subunit HslU

>NIGA_02450 ATP-dependent protease subunit HslV

>NIGA_02460 tyrosine recombinase XerC

>NIGA_02470 tRNA (uracil-5-)-methyltransferase Gid

>NIGA_02480 DNA topoisomerase I

>NIGA_02490 DNA processing protein

>NIGA_02500 ribonuclease HII

>NIGA_02510 ribosome biogenesis GTPase A

>NIGA_02520 hypothetical protein

>NIGA_02530 DegV family protein

>NIGA_02540 hemolysin III

>NIGA_02550 tRNA CCA-pyrophosphorylase

>NIGA_02560 YitT family membrane protein

>NIGA_02570 hypothetical protein

>NIGA_02580 hypothetical protein

>NIGA_02590 hypothetical protein

>NIGA_02600 hypothetical protein

>NIGA_02610 multidrug ABC transporter ATP-binding and permease protein

>NIGA_02620 hypothetical protein

>NIGA_02630 hypothetical protein

>NIGA_02640 LysR family transcriptional regulator

>NIGA_02650 hypothetical protein

>NIGA_02660 membrane-associated phospholipid phosphatase

>NIGA_02670 DegV family protein

>NIGA_02680 enolase

>NIGA_02690 hypothetical protein

>NIGA_02700 amino acid ABC transporter ATP-binding protein

>NIGA_02710 amino acid ABC transporter substrate-binding and permease protein

>NIGA_02720 LysR family transcriptional regulator

>NIGA_02730 cation-transporting ATPase

>NIGA_02740 membrane protein

>NIGA_02750 branched-chain amino acid aminotransferase

>NIGA_02760 cation transporter

>NIGA_02770 ArsR family transcriptional regulator

>NIGA_02780 adenine phosphoribosyltransferase

>NIGA_02790 single-stranded-DNA-specific exonuclease RecJ

>NIGA_02800 sortase

>NIGA_02810 translation elongation factor LepA

>NIGA_02820 molecular chaperone DnaJ

>NIGA_02830 molecular chaperone DnaK

>NIGA_02840 heat shock protein GrpE

>NIGA_02850 heat-inducible transcription repressor HrcA

>NIGA_02860 riboflavin biosynthesis protein RibF

>NIGA_02870 integrase/recombinase family protein

>NIGA_02880 transposase

>NIGA_02890 cysteine synthase

>NIGA_02900 cystathionine beta-lyase

>NIGA_02910 serine acetyltransferase

>NIGA_02920 acetoin dehydrogenase

>NIGA_02930 tRNA pseudouridine synthase B

>NIGA_02940 ribosome-binding factor A

>NIGA_02950 translation initiation factor IF-2

>NIGA_02960 50S ribosomal protein L7ae

>NIGA_02970 hypothetical protein

>NIGA_02980 transcription termination factor NusA

>NIGA_02990 ribosome maturation protein RimP

>NIGA_03000 DNA polymerase III alpha subunit

>NIGA_03010 prolyl-tRNA synthetase

>NIGA_03020 metalloprotease RseP

>NIGA_03030 phosphatidate cytidylyltransferase

>NIGA_03040 UDP pyrophosphate synthase

>NIGA_03050 ribosome recycling factor

>NIGA_03060 uridylate kinase

>NIGA_03070 translation elongation factor Ts

>NIGA_03080 30S ribosomal protein S2

>NIGA_03090 O-methyltransferase

>NIGA_03100 1-acyl-sn-glycerol-3-phosphate acyltransferase

>NIGA_03110 aspartate-semialdehyde dehydrogenase

>NIGA_03120 aspartate kinase

>NIGA_03130 homoserine dehydrogenase

>NIGA_03140 ACT domain-containing protein

>NIGA_03150 multidrug ABC transporter ATP-binding and permease protein

>NIGA_03160 multidrug ABC transporter ATP-binding and permease protein

>NIGA_03170 hypothetical protein

>NIGA_03180 hypothetical protein

>NIGA_03190 LexA repressor

>NIGA_03200 glucose uptake protein

>NIGA_03210 glutamine ABC transporter substrate-binding protein

>NIGA_03220 hypothetical protein

>NIGA_03230 ATP-dependent helicase

>NIGA_03240 biotin carboxylase

>NIGA_03250 hypothetical protein

>NIGA_03260 hypothetical protein

>NIGA_03270 hypothetical protein

>NIGA_03280 5'-nucleotidase

>NIGA_03290 50S ribosomal protein L19

>NIGA_03300 SNF2 family DNA/RNA helicase

>NIGA_03310 tRNA (guanine-N1)-methyltransferase

>NIGA_03320 16S rRNA processing protein RimM

>NIGA_03330 30S ribosomal protein S16

>NIGA_03340 signal recognition particle protein

>NIGA_03350 DNA-binding protein

>NIGA_03360 hypothetical protein

>NIGA_03370 hypothetical protein

>NIGA_03380 chromosome segregation protein SMC

>NIGA_03390 hypothetical protein

>NIGA_03400 acyl carrier protein

>NIGA_03410 phosphate acyltransferase

>NIGA_03420 ATP-dependent DNA helicase RecG

>NIGA_03430 DAK2 domain fusion protein YloV

>NIGA_03440 hypothetical protein

>NIGA_03450 50S ribosomal protein L28

>NIGA_03460 multidrug ABC transporter ATP-binding and permease protein

>NIGA_03470 hypothetical protein

>NIGA_03480 hypothetical protein

>NIGA_03490 thiamine pyrophosphokinase

>NIGA_03500 ribosome biogenesis GTPase RsgA

>NIGA_03510 serine/threonine protein kinase

>NIGA_03520 serine/threonine protein phosphatase

>NIGA_03530 16S rRNA methyltransferase

>NIGA_03540 methionyl-tRNA formyltransferase

>NIGA_03550 primosomal protein N'

>NIGA_03560 DNA-directed RNA polymerase subunit omega

>NIGA_03570 guanylate kinase

>NIGA_03580 hypothetical protein

>NIGA_03590 hypothetical protein

>NIGA_03600 hypothetical protein

>NIGA_03610 DNA repair protein RecN

>NIGA_03620 cell division protein FtsJ

>NIGA_03630 geranyltranstransferase

>NIGA_03640 exodeoxyribonuclease VII small subunit

>NIGA_03650 exodeoxyribonuclease VII large subunit

>NIGA_03660 bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase / 5,10-methylene-tetrahydrofolate cyclohydrolase

>NIGA_03670 transcription antitermination factor NusB

>NIGA_03680 alkaline shock protein

>NIGA_03690 translation elongation factor P

>NIGA_03700 Xaa-Pro aminopeptidase

>NIGA_03710 50S ribosomal protein L27

>NIGA_03720 50S ribosomal protein L21

>NIGA_03730 arsenate reductase

>NIGA_03740 cystathionine gamma-synthase

>NIGA_03750 cystathionine gamma-lyase

>NIGA_03760 ABC-type branched-chain amino acid transport system, ATPase component

>NIGA_03770 phosphoribosylamine-glycine ligase

>NIGA_03780 bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase

>NIGA_03790 phosphoribosylglycinamide formyltransferase

>NIGA_03800 phosphoribosylformylglycinamidine cyclo-ligase

>NIGA_03810 amidophosphoribosyltransferase

>NIGA_03820 phosphoribosylformylglycinamidine synthase II

>NIGA_03830 phosphoribosylformylglycinamidine synthase I

>NIGA_03840 phosphoribosylformylglycinamidine synthase

>NIGA_03850 phosphoribosylaminoimidazole-succinocarboxamide synthase

>NIGA_03860 adenylosuccinate lyase

>NIGA_03870 phosphoribosylaminoimidazole carboxylase ATPase subunit

>NIGA_03880 phosphoribosylaminoimidazole carboxylase catalytic subunit

>NIGA_03890 hypothetical protein

>NIGA_03900 hypothetical protein

>NIGA_03910 hypothetical protein

>NIGA_03920 hypothetical protein

>NIGA_03930 hypothetical protein

>NIGA_03940 hypothetical protein

>NIGA_03950 hypothetical protein

>NIGA_03960 DNA topoisomerase III

>NIGA_03970 Xaa-Pro dipeptidyl-peptidase

>NIGA_03980 hypothetical protein

>NIGA_03990 hypothetical protein

>NIGA_04000 homoserine O-succinyltransferase

>NIGA_04010 cysteine synthase

>NIGA_04020 cyclopropane-fatty-acyl-phospholipid synthase

>NIGA_04030 endopeptidase o

>NIGA_04040 adenosine deaminase

>NIGA_04050 hypothetical protein

>NIGA_04060 DegV family protein

>NIGA_04070 hypothetical protein

>NIGA_04080 hypothetical protein

>NIGA_04090 hypothetical protein

>NIGA_04100 hypothetical protein

>NIGA_04110 hypothetical protein

>NIGA_04120 major facilitator superfamily transporter

>NIGA_04130 glutamine synthetase

>NIGA_04140 aluminum resistance protein

>NIGA_04150 tRNA delta(2)-isopentenylpyrophosphate transferase

>NIGA_04160 rhodanese-like domain protein

>NIGA_04170 hypothetical protein

>NIGA_04180 membrane-associated serine protease

>NIGA_04190 5-formyltetrahydrofolate cyclo-ligase

>NIGA_04200 50S ribosomal protein L33

>NIGA_04210 penicillin-binding protein 2B

>NIGA_04220 bacterial membrane protein YfhO

>NIGA_04230 transcription elongation factor GreA

>NIGA_04240 phenylalanyl-tRNA synthetase subunit beta

>NIGA_04250 phenylalanyl-tRNA synthetase subunit alpha

>NIGA_04260 HxlR family transcriptional regulator

>NIGA_04270 rRNA methyltransferase

>NIGA_04280 acylphosphatase

>NIGA_04290 preprotein translocase subunit YidC

>NIGA_04300 two-component system sensor histidine kinase

>NIGA_04310 two-component system response regulator

>NIGA_04320 DNA-binding protein

>NIGA_04330 nucleotidyltransferase

>NIGA_04340 ribosome silencing factor RsfS

>NIGA_04350 hypothetical protein

>NIGA_04360 nicotinic acid mononucleotide adenylyltransferase

>NIGA_04370 GTPase

>NIGA_04380 50S ribosomal protein L20

>NIGA_04390 50S ribosomal protein L35

>NIGA_04400 translation initiation factor IF-3

>NIGA_04410 ATPase

>NIGA_04420 hypothetical protein

>NIGA_04430 hypothetical protein

>NIGA_04440 hypothetical protein

>NIGA_04450 threonyl-tRNA synthetase

>NIGA_04460 primosomal protein DnaI

>NIGA_04470 replicative DNA helicase

>NIGA_04480 NrdR family transcriptional regulator

>NIGA_04490 dephospho-CoA kinase

>NIGA_04500 formamidopyrimidine-DNA glycosylase

>NIGA_04510 DNA polymerase I

>NIGA_04520 hypothetical protein

>NIGA_04530 tRNA binding domain protein

>NIGA_04540 thiol-disulfide isomerase / thioredoxin

>NIGA_04550 tRNA (guanine-N(7)-)-methyltransferase

>NIGA_04560 multidrug ABC transporter permease protein

>NIGA_04570 ABC transporter ATP-binding protein

>NIGA_04580 histidine triad protein HIT

>NIGA_04590 hypothetical protein

>NIGA_04600 dihydroorotate dehydrogenase

>NIGA_04610 orotidine 5'-phosphate decarboxylase

>NIGA_04620 orotate phosphoribosyltransferase

>NIGA_04630 peptidylprolyl isomerase

>NIGA_04640 hypothetical protein

>NIGA_04650 shikimate kinase

>NIGA_04660 3'-5' exoribonuclease YhaM

>NIGA_04670 DNA repair ATPase

>NIGA_04680 phosphoesterase

>NIGA_04690 hypothetical protein

>NIGA_04700 penicillin-binding protein 2A

>NIGA_04710 ribosomal large subunit pseudouridine synthase D

>NIGA_04720 fructose-bisphosphate aldolase

>NIGA_04730 cell surface protein

>NIGA_04740 hypothetical protein

>NIGA_04750 hypothetical protein

>NIGA_04760 transposase

>NIGA_04770 hypothetical protein

>NIGA_04780 hypothetical protein

>NIGA_04790 carbohydrate kinase

>NIGA_04800 D-alanyl-D-alanine carboxypeptidase

>NIGA_04810 putative membrane protein

>NIGA_04820 phosphoenolpyruvate synthase

>NIGA_04830 polysaccharide transport membrane protein

>NIGA_04840 leucyl-tRNA synthetase

>NIGA_04850 membrane-associated phospholipid phosphatase

>NIGA_04860 major facilitator superfamily transporter

>NIGA_04870 S-adenosylmethionine synthetase

>NIGA_04880 thioredoxin reductase

>NIGA_04890 DedA family protein

>NIGA_04900 membrane protein

>NIGA_04910 HAD family hydrolase

>NIGA_04920 transcriptional regulator

>NIGA_04930 5'-nucleotidase

>NIGA_04940 hypothetical protein

>NIGA_04950 catabolite control protein A

>NIGA_04960 proline dipeptidase

>NIGA_04970 hypothetical protein

>NIGA_04980 hypothetical protein

>NIGA_04990 chemotaxis protein

>NIGA_05000 small-conductance mechanosensitive channel

>NIGA_05010 nucleoside-triphosphate diphosphatase

>NIGA_05020 hypothetical protein

>NIGA_05030 thiol-disulfide isomerase / thioredoxin

>NIGA_05040 DNA mismatch repair protein MutS

>NIGA_05050 hypothetical protein

>NIGA_05060 Holliday junction resolvase

>NIGA_05070 hypothetical protein

>NIGA_05080 alanyl-tRNA synthetase

>NIGA_05090 DEAD/DEAH box helicase

>NIGA_05100 phosphoesterase

>NIGA_05110 DNA polymerase IV

>NIGA_05120 glucose-6-phosphate 1-dehydrogenase

>NIGA_05130 hypothetical protein

>NIGA_05140 Holliday junction DNA helicase RuvB

>NIGA_05150 Holliday junction DNA helicase RuvA

>NIGA_05160 hypothetical protein

>NIGA_05170 DNA mismatch repair protein MutS

>NIGA_05180 chaperonin GroEL

>NIGA_05190 co-chaperonin GroES

>NIGA_05200 redox-sensing transcriptional repressor Rex

>NIGA_05210 hypothetical protein

>NIGA_05220 hypothetical protein

>NIGA_05230 tRNA threonylcarbamoyladenosine modification protein TsaD

>NIGA_05240 ribosomal-protein-alanine acetyltransferase

>NIGA_05250 tRNA threonylcarbamoyladenosine biosynthesis protein TsaB

>NIGA_05260 hypothetical protein

>NIGA_05270 acyl-ACP thioesterase

>NIGA_05280 16S rRNA methyltransferase

>NIGA_05290 DNA replication initiation control protein YabA

>NIGA_05300 DNA polymerase III subunit delta'

>NIGA_05310 hypothetical protein

>NIGA_05320 thymidylate kinase

>NIGA_05330 hypothetical protein

>NIGA_05340 recombinase RecR

>NIGA_05350 DNA-binding protein YbaB

>NIGA_05360 DNA polymerase III subunit gamma/tau

>NIGA_05370 deaminase

>NIGA_05380 16S rRNA methyltransferase

>NIGA_05390 uracil phosphoribosyltransferase

>NIGA_05400 hypothetical protein

>NIGA_05410 hypothetical protein

>NIGA_05420 hypothetical protein

>NIGA_05430 beta-N-acetylhexosaminidase

>NIGA_05440 hypothetical protein

>NIGA_05450 glycine betaine/carnitine/choline ABC transporter permease protein

>NIGA_05460 glycine betaine/carnitine/choline ABC transporter substrate-binding protein

>NIGA_05470 glycine betaine/carnitine/choline ABC transporter permease protein

>NIGA_05480 glycine betaine/carnitine/choline ABC transporter ATP-binding protein

>NIGA_05490 hypothetical protein

>NIGA_05500 DNA-binding protein HU

>NIGA_05510 hypothetical protein

>NIGA_05520 50S ribosomal protein L7/L12

>NIGA_05530 50S ribosomal protein L10

>NIGA_05540 hypothetical protein

>NIGA_05550 ammonium transporter

>NIGA_05560 glycosyl transferase

>NIGA_05570 50S ribosomal protein L1

>NIGA_05580 50S ribosomal protein L11

>NIGA_05590 transcriptional antiterminator NusG

>NIGA_05600 preprotein translocase subunit SecE

>NIGA_05610 50S ribosomal protein L33

>NIGA_05620 1-deoxy-D-xylulose-5-phosphate synthase

>NIGA_05630 hypothetical protein

>NIGA_05640 hypothetical protein

>NIGA_05650 DNA-directed RNA polymerase specialized sigma subunit

>NIGA_05660 rRNA methyltransferase

>NIGA_05670 mini-ribonuclease 3

>NIGA_05680 cysteinyl-tRNA synthetase

>NIGA_05690 NUDIX family hydrolase

>NIGA_05700 hypothetical protein

>NIGA_05710 LysR family transcriptional regulator

>NIGA_05720 membrane protein

>NIGA_05730 glutamyl-tRNA synthetase

>NIGA_05740 ABC transporter permease protein

>NIGA_05750 ABC transporter ATP-binding protein

>NIGA_05760 GntR family transcriptional regulator

>NIGA_05770 oligopeptide ABC transporter substrate-binding protein

>NIGA_05780 NUDIX family hydrolase

>NIGA_05790 acetyl-CoA carboxylase, biotin carboxylase subunit

>NIGA_05800 hypothetical protein

>NIGA_05810 hypothetical protein

>NIGA_05820 hypothetical protein

>NIGA_05830 major facilitator superfamily transporter

>NIGA_05840 proline dipeptidase

>NIGA_05850 hypothetical protein

>NIGA_05860 hypothetical protein

>NIGA_05870 hypothetical protein

>NIGA_05880 membrane protein

>NIGA_05890 aldehyde dehydrogenase

>NIGA_05900 energy-coupling factor transporter transmembrane protein

>NIGA_05910 energy-coupling factor transporter ATP-binding protein

>NIGA_05920 membrane protein

>NIGA_05930 S-adenosyl-l-methionine hydroxide adenosyltransferase family protein

>NIGA_05940 amino acid permease

>NIGA_05950 membrane protein

>NIGA_05960 ABC transporter ATP-binding protein

>NIGA_05970 GntR family transcriptional regulator

>NIGA_05980 hypothetical protein

>NIGA_05990 hypothetical protein

>NIGA_06000 hypothetical protein

>NIGA_06010 lipopolysaccharide biosynthesis glycosyltransferase

>NIGA_06020 DNA repair protein RadA

>NIGA_06030 deoxyuridine 5'-triphosphate nucleotidohydrolase

>NIGA_06040 hypothetical protein

>NIGA_06050 aminopeptidase C

>NIGA_06060 hypothetical protein

>NIGA_06070 2', 3'-cyclic nucleotide 2'-phosphodiesterase

>NIGA_06080 3-hydroxyacyl-ACP dehydratase

>NIGA_06090 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase

>NIGA_06100 hypothetical protein

>NIGA_06110 hypothetical protein

>NIGA_06120 phosphoglycerate mutase

>NIGA_06130 sulfite exporter TauE/SafE family protein

>NIGA_06140 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein

>NIGA_06150 GNAT family acetyltransferase

>NIGA_06160 L-alanine-DL-glutamate epimerase

>NIGA_06170 beta-lactamase class A

>NIGA_06180 hypothetical protein

>NIGA_06190 dipeptidase PepV

>NIGA_06200 amino acid permease

>NIGA_06210 hypothetical protein

>NIGA_06220 galactose-6-phosphate isomerase subunit LacB

>NIGA_06230 galactose-6-phosphate isomerase subunit LacA

>NIGA_06240 DeoR family transcriptional regulator

>NIGA_06250 aldose 1-epimerase

>NIGA_06260 tagatose-6-phosphate kinase

>NIGA_06270 tagatose-bisphosphate aldolase

>NIGA_06280 hypothetical protein

>NIGA_06290 galactitol-specific PTS system IIC component

>NIGA_06300 PTS system IIB component

>NIGA_06310 PTS sugar transporter IIA component

>NIGA_06320 hypothetical protein

>NIGA_06330 hypothetical protein

>NIGA_06340 6-phospho-beta-galactosidase

>NIGA_06350 lactose-specific PTS system IIBC component

>NIGA_06360 transcriptional antiterminator

>NIGA_06370 lactose-specific PTS system IIA component

>NIGA_06380 aldose 1-epimerase

>NIGA_06390 galactokinase

>NIGA_06400 galactose-1-phosphate uridylyltransferase

>NIGA_06410 aspartate ammonia-lyase

>NIGA_06420 hypothetical protein

>NIGA_06430 aggregation promoting factor

>NIGA_06440 homoserine kinase

>NIGA_06450 threonine synthase

>NIGA_06460 GNAT family acetyltransferase

>NIGA_06470 hypothetical protein

>NIGA_06480 LacI family transcriptional regulator

>NIGA_06490 sucrose-6-phosphate hydrolase

>NIGA_06500 PTS system, sucrose-specific IIABC component

>NIGA_06510 6-phosphofructokinase

>NIGA_06520 phosphoglucomutase

>NIGA_06530 hypothetical protein

>NIGA_06540 hypothetical protein

>NIGA_06550 hypothetical protein

>NIGA_06560 hypothetical protein

>NIGA_06570 hypothetical protein

>NIGA_06580 hypothetical protein

>NIGA_06590 restriction endonuclease subunit R

>NIGA_06600 DNA methyltransferase

>NIGA_06610 hypothetical protein

>NIGA_06620 hypothetical protein

>NIGA_06630 alpha-amylase

>NIGA_06640 major facilitator superfamily transporter

>NIGA_06650 XRE family transcriptional regulator

>NIGA_06660 DNA (cytosine-5-)-methyltransferase

>NIGA_06670 phospholipase D family protein

>NIGA_06680 hypothetical protein

>NIGA_06690 hypothetical protein

>NIGA_06700 hypothetical protein

>NIGA_06710 Z1 domain-containing protein

>NIGA_06720 hypothetical protein

>NIGA_06730 T/G mismatch-specific endonuclease

>NIGA_06740 restriction endonuclease

>NIGA_06750 putative helicase

>NIGA_06760 hypothetical protein

>NIGA_06770 restriction endonuclease

>NIGA_06780 cytosine methyltransferase

>NIGA_06790 UDP-glucose 4-epimerase

>NIGA_06800 dipeptidyl-peptidase

>NIGA_06810 amino acid permease

>NIGA_06820 hypothetical protein

>NIGA_06830 hypothetical protein

>NIGA_06840 hypothetical protein

>NIGA_06850 mannose-specific PTS system IID component

>NIGA_06860 mannose-specific PTS system IIC component

>NIGA_06870 mannose/fructose/sorbose-specific PTS system IIAB component

>NIGA_06880 Na+/H+ antiporter

>NIGA_06890 hypothetical protein

>NIGA_06900 hypothetical protein

>NIGA_06910 Fe-S cluster assembly protein SufB

>NIGA_06920 nitrogen fixation protein NifU

>NIGA_06930 cysteine desulfurase

>NIGA_06940 Fe-S cluster assembly protein SufD

>NIGA_06950 Fe-S cluster assembly ATPase SufC

>NIGA_06960 GNAT family acetyltransferase

>NIGA_06970 glucose specific PTS system IIA component

>NIGA_06980 hypothetical protein

>NIGA_06990 RpiR family transcriptional regulator

>NIGA_07000 alpha-glucoside-specific PTS system IIBC component

>NIGA_07010 hypothetical protein

>NIGA_07020 6-phospho-alpha-glucosidase

>NIGA_07030 hypothetical protein

>NIGA_07040 antimicrobial peptide ABC transporter ATP-binding protein

>NIGA_07050 hypothetical protein

>NIGA_07060 hypothetical protein

>NIGA_07070 hypothetical protein

>NIGA_07080 SsrA-binding protein

>NIGA_07090 exoribonuclease R

>NIGA_07100 preprotein translocase subunit SecG

>NIGA_07110 alkaline phosphatase

>NIGA_07120 hypothetical protein

>NIGA_07130 membrane protein

>NIGA_07140 glycosyl transferase

>NIGA_07150 glycosyltransferase

>NIGA_07160 hypothetical protein

>NIGA_07170 arginine/ornithine antiporter

>NIGA_07180 arginine deiminase

>NIGA_07190 carbamate kinase

>NIGA_07200 ornithine/putrescine carbamoyltransferase

>NIGA_07210 chemotaxis protein CheY

>NIGA_07220 B3/4 domain protein

>NIGA_07230 hypothetical protein

>NIGA_07240 anti-sigma factor

>NIGA_07250 DNA-directed RNA polymerase specialized sigma subunit

>NIGA_07260 seryl-tRNA synthetase

>NIGA_07270 N-acetyltransferase

>NIGA_07280 membrane protein

>NIGA_07290 esterase

>NIGA_07300 Cro/Cl family transcriptional regulator

>NIGA_07310 nucleoside 2-deoxyribosyltransferase

>NIGA_07320 glutamine amidotransferase

>NIGA_07330 succinate-semialdehyde dehydrogenase

>NIGA_07340 membrane protein

>NIGA_07350 membrane protein

>NIGA_07360 TetR family transcriptional regulator

>NIGA_07370 hypothetical protein

>NIGA_07380 beta-lactamase class A

>NIGA_07390 magnesium and cobalt transporter

>NIGA_07400 prolyl aminopeptidase

>NIGA_07410 GNAT family acetyltransferase

>NIGA_07420 putative esterase

>NIGA_07430 hypothetical protein

>NIGA_07440 DNA-entry nuclease

>NIGA_07450 2,5-diketo-D-gluconic acid reductase

>NIGA_07460 hypothetical protein

>NIGA_07470 hypothetical protein

>NIGA_07480 hypothetical protein

>NIGA_07490 oxidoreductase

>NIGA_07500 multidrug ABC transporter ATP-binding and permease protein

>NIGA_07510 prolyl aminopeptidase

>NIGA_07520 LysM domain protein

>NIGA_07530 translation elongation factor P

>NIGA_07540 pantothenate kinase

>NIGA_07550 esterase

>NIGA_07560 LytR family transcriptional regulator

>NIGA_07570 hypothetical protein

>NIGA_07580 amino acid ABC transporter substrate-binding protein

>NIGA_07590 amino acid ABC transporter ATP-binding protein

>NIGA_07600 amino acid ABC transporter permease protein

>NIGA_07610 ATP-dependent DNA helicase

>NIGA_07620 hypothetical protein

>NIGA_07630 phosphoglycerate mutase

>NIGA_07640 glycerophosphoryl diester phosphodiesterase

>NIGA_07650 hypothetical protein

>NIGA_07660 hypothetical protein

>NIGA_07670 hypothetical protein

>NIGA_07680 cell wall teichoic acid glycosylation protein

>NIGA_07690 putative integral membrane protein

>NIGA_07700 hypothetical protein

>NIGA_07710 hypothetical protein

>NIGA_07720 hypothetical protein

>NIGA_07730 hypothetical protein

>NIGA_07740 hypothetical protein

>NIGA_07750 glycerol-3-phosphate cytidylyltransferase

>NIGA_07760 lipopolysaccharide cholinephosphotransferase

>NIGA_07770 flippase

>NIGA_07780 hypothetical protein

>NIGA_07790 hypothetical protein

>NIGA_07800 hypothetical protein

>NIGA_07810 glycosyltransferase

>NIGA_07820 UDP-galactopyranose mutase

>NIGA_07830 glycosyltransferase

>NIGA_07840 hypothetical protein

>NIGA_07850 LytR family transcriptional regulator

>NIGA_07860 LytR family transcriptional regulator

>NIGA_07870 hypothetical protein

>NIGA_07880 DNA-entry nuclease

>NIGA_07890 hypothetical protein

>NIGA_07900 XRE family transcriptional regulator

>NIGA_07910 glycerol-3-phosphate dehydrogenase

>NIGA_07920 hypothetical protein

>NIGA_07930 hypothetical protein

>NIGA_07940 hypothetical protein

>NIGA_07950 hypothetical protein

>NIGA_07960 hypothetical protein

>NIGA_07970 hypothetical protein

>NIGA_07980 GntR family transcriptional regulator

>NIGA_07990 alpha, alpha-phosphotrehalase

>NIGA_08000 hypothetical protein

>NIGA_08010 hypothetical protein

>NIGA_08020 hypothetical protein

>NIGA_08030 peptide methionine sulfoxide reductase MsrB

>NIGA_08040 hypothetical protein

>NIGA_08050 dTDP-4-dehydrorhamnose reductase

>NIGA_08060 dTDP-4-dehydrorhamnose 3,5-epimerase

>NIGA_08070 glucose-1-phosphate thymidylyltransferase

>NIGA_08080 dTDP-glucose 4,6-dehydratase

>NIGA_08090 MerR family transcriptional regulator

>NIGA_08100 glycerol uptake facilitator protein

>NIGA_08110 hypothetical protein

>NIGA_08120 hypothetical protein

>NIGA_08130 fumarate reductase flavoprotein subunit

>NIGA_08140 LysR family transcriptional regulator

>NIGA_08150 hypothetical protein

>NIGA_08160 hypothetical protein

>NIGA_08170 hypothetical protein

>NIGA_08180 hypothetical protein

>NIGA_08190 poly-gamma-glutamate biosynthesis protein

>NIGA_08200 hypothetical protein

>NIGA_08210 hypothetical protein

>NIGA_08220 hypothetical protein

>NIGA_08230 hypothetical protein

>NIGA_08240 glycosyltransferase

>NIGA_08250 glycosyltransferase

>NIGA_08260 hypothetical protein

>NIGA_08270 hypothetical protein

>NIGA_08280 glycosyltransferase

>NIGA_08290 exopolysaccharide biosynthesis protein

>NIGA_08300 exopolysaccharide biosynthesis protein

>NIGA_08310 exopolysaccharide biosynthesis protein

>NIGA_08320 LytR family transcriptional regulator

>NIGA_08330 GTP-binding protein

>NIGA_08340 cell wall-associated hydrolase

>NIGA_08350 cell wall-associated hydrolase

>NIGA_08360 hypothetical protein

>NIGA_08370 cell wall-associated hydrolase

>NIGA_08380 cell wall-associated hydrolase

>NIGA_08390 beta-glucanase

>NIGA_08400 glycosyltransferase

>NIGA_08410 hypothetical protein

>NIGA_08420 hypothetical protein

>NIGA_08430 D-lactate dehydrogenase

>NIGA_08440 cell wall-associated hydrolase

>NIGA_08450 guanylate kinase

>NIGA_08460 hypothetical protein

>NIGA_08470 hypothetical protein

>NIGA_08480 hypothetical protein

>NIGA_08490 hypothetical protein

>NIGA_08500 transposase

>NIGA_08510 hypothetical protein

>NIGA_08520 hypothetical protein

>NIGA_08530 hypothetical protein

>NIGA_08540 membrane protein

>NIGA_08550 membrane protein

>NIGA_08560 ATPase component of ABC transporter with duplicated ATPase domains

>NIGA_08570 hypothetical protein

>NIGA_08580 LytR family transcriptional regulator

>NIGA_08590 alpha-glucosidase

>NIGA_08600 LacI family transcriptional regulator

>NIGA_08610 oligo-1,6-glucosidase

>NIGA_08620 acetyl esterase

>NIGA_08630 membrane protein

>NIGA_08640 membrane protein

>NIGA_08650 transcriptional regulator

>NIGA_08660 D-alanine-D-alanine ligase

>NIGA_08670 serine protease

>NIGA_08680 ArcR family transcriptional regulator

>NIGA_08690 hypothetical protein

>NIGA_08700 hypothetical protein

>NIGA_08710 hypothetical protein

>NIGA_08720 ribose-phosphate pyrophosphokinase

>NIGA_08730 hypothetical protein

>NIGA_08740 alpha/beta hydrolase

>NIGA_08750 glycosyl transferase

>NIGA_08760 hypothetical protein

>NIGA_08770 ribonuclease HI

>NIGA_08780 alpha/beta hydrolase

>NIGA_08790 cardiolipin synthase

>NIGA_08800 hypothetical protein

>NIGA_08810 NAD-dependent deacetylase

>NIGA_08820 hypothetical protein

>NIGA_08830 3-methyladenine DNA glycosylase

>NIGA_08840 amino acid ABC transporter substrate-binding and permease protein

>NIGA_08850 amino acid ABC transporter ATP-binding protein

>NIGA_08860 hypothetical protein

>NIGA_08870 hypothetical protein

>NIGA_08880 hypothetical protein

>NIGA_08890 cell wall-associated hydrolase

>NIGA_08900 restriction endonuclease

>NIGA_08910 hypothetical protein

>NIGA_08920 cation transporter

>NIGA_08930 LemA family protein

>NIGA_08940 heat-shock protein HtpX

>NIGA_08950 hypothetical protein

>NIGA_08960 hypothetical protein

>NIGA_08970 XRE family transcriptional regulator

>NIGA_08980 AraC family transcriptional regulator

>NIGA_08990 major facilitator superfamily transporter

>NIGA_09000 energy-coupling factor transporter ATP-binding protein

>NIGA_09010 hypothetical protein

>NIGA_09020 hypothetical protein

>NIGA_09030 pyridoxamine 5'-phosphate oxidase

>NIGA_09040 hypothetical protein

>NIGA_09050 hypothetical protein

>NIGA_09060 hypothetical protein

>NIGA_09070 XRE family transcriptional regulator

>NIGA_09080 rRNA methyltransferase

>NIGA_09090 serine protease

>NIGA_09100 metal-dependent hydrolase

>NIGA_09110 hypothetical protein

>NIGA_09120 hypothetical protein

>NIGA_09130 two-component system sensor histidine kinase

>NIGA_09140 two-component system response regulator

>NIGA_09150 1-acyl-sn-glycerol-3-phosphate acyltransferase

>NIGA_09160 lipopolysaccharide biosynthesis glycosyltransferase

>NIGA_09170 phospho-beta-glycosidase

>NIGA_09180 hypothetical protein

>NIGA_09190 DUF1906 domain-containing protein

>NIGA_09200 hypothetical protein

>NIGA_09210 peptidase S24-like protein

>NIGA_09220 hypothetical protein

>NIGA_09230 ATPase

>NIGA_09240 alpha/beta hydrolase

>NIGA_09250 hypothetical protein

>NIGA_09260 hypothetical protein

>NIGA_09270 fumarate reductase flavoprotein subunit

>NIGA_09280 LysR family transcriptional regulator

>NIGA_09290 shikimate 5-dehydrogenase

>NIGA_09300 hypothetical protein

>NIGA_09310 hypothetical protein

>NIGA_09320 hypothetical protein

>NIGA_09330 hypothetical protein

>NIGA_09340 LysR family transcriptional regulator

>NIGA_09350 hypothetical protein

>NIGA_09360 major facilitator superfamily transporter

>NIGA_09370 L-lactate dehydrogenase

>NIGA_09380 glucokinase

>NIGA_09390 5-methyltetrahydropteroyltriglutamate--homocystei ne methyltransferase

>NIGA_09400 LysR family transcriptional regulator

>NIGA_09410 hypothetical protein

>NIGA_09420 S-ribosylhomocysteinase

>NIGA_09430 hypothetical protein

>NIGA_09440 peptide deformylase

>NIGA_09450 FAD/FMN-containing dehydrogenase

>NIGA_09460 D-lactate dehydrogenase

>NIGA_09470 cobalamin adenosyltransferase CobO

>NIGA_09480 membrane protein

>NIGA_09490 hypothetical protein

>NIGA_09500 ribonucleoside-triphosphate reductase

>NIGA_09510 2,5-diketo-D-gluconic acid reductase

>NIGA_09520 L-2-hydroxyisocaproate dehydrogenase

>NIGA_09530 hypothetical protein

>NIGA_09540 exodeoxyribonuclease III

>NIGA_09550 hypothetical protein

>NIGA_09560 HAD family hydrolase

>NIGA_09570 biotin biosynthesis protein BioY

>NIGA_09580 hypothetical protein

>NIGA_09590 hypothetical protein

>NIGA_09600 hypothetical protein

>NIGA_09610 hypothetical protein

>NIGA_09620 hypothetical protein

>NIGA_09630 phosphoglycerate mutase

>NIGA_09640 esterase

>NIGA_09650 hypothetical protein

>NIGA_09660 DegV family protein

>NIGA_09670 hypothetical protein

>NIGA_09680 glutathione reductase

>NIGA_09690 hypothetical protein

>NIGA_09700 hypothetical protein

>NIGA_09710 ATPase, para family protein

>NIGA_09720 hypothetical protein

>NIGA_09730 DNA-binding ferritin-like protein

>NIGA_09740 hypothetical protein

>NIGA_09750 hypothetical protein

>NIGA_09760 cell wall teichoic acid glycosylation protein

>NIGA_09770 hypothetical protein

>NIGA_09780 hypothetical protein

>NIGA_09790 phage primase

>NIGA_09800 hypothetical protein

>NIGA_09810 hypothetical protein

>NIGA_09820 sucrose phosphorylase

>NIGA_09830 sucrose operon repressor

>NIGA_09840 glycerol uptake facilitator protein

>NIGA_09850 DNA-directed RNA polymerase specialized sigma subunit

>NIGA_09860 hypothetical protein

>NIGA_09870 hypothetical protein

>NIGA_09880 transposase

>NIGA_09890 transposase

>NIGA_09900 fructokinase

>NIGA_09910 mannose-6-phosphate isomerase

>NIGA_09920 6-phospho-beta-glucosidase

>NIGA_09930 hypothetical protein

>NIGA_09940 transcriptional regulator

>NIGA_09950 4-oxalocrotonate tautomerase

>NIGA_09960 hypothetical protein

>NIGA_09970 hypothetical protein

>NIGA_09980 Rrf2 family transcriptional regulator

>NIGA_09990 hypothetical protein

>NIGA_10000 predicted integral membrane protein

>NIGA_10010 helicase

>NIGA_10020 membrane protein

>NIGA_10030 pyridoxal kinase

>NIGA_10040 GNAT family acetyltransferase

>NIGA_10050 lysin

>NIGA_10060 hypothetical protein

>NIGA_10070 ABC transporter permease protein

>NIGA_10080 ABC transporter ATP-binding protein

>NIGA_10090 hypothetical protein

>NIGA_10100 hypothetical protein

>NIGA_10110 hypothetical protein

>NIGA_10120 magnesium transporter MgtC

>NIGA_10130 hypothetical protein

>NIGA_10140 hypothetical protein

>NIGA_10150 hypothetical protein

>NIGA_10160 esterase

>NIGA_10170 replicative DNA helicase

>NIGA_10180 50S ribosomal protein L9

>NIGA_10190 DHH family phosphoesterase

>NIGA_10200 30S ribosomal protein S18

>NIGA_10210 single-stranded DNA-binding protein

>NIGA_10220 30S ribosomal protein S6

>NIGA_10230 DNA gyrase subunit A

>NIGA_10240 DNA gyrase subunit B

>NIGA_10250 DNA replication and repair protein RecF

>NIGA_10260 S4-like RNA binding protein

>NIGA_10270 DNA polymerase III subunit beta

>NIGA_10280 chromosomal replication initiator protein DnaA

>NIGA_10290 ribonuclease P

>NIGA_10300 preprotein translocase subunit YidC

>NIGA_10310 tRNA modification GTPase

>NIGA_10320 tRNA uridine 5-carboxymethylaminomethyl modification protein GidA

>NIGA_10330 6-phosphogluconate dehydrogenase

>NIGA_10340 hypothetical protein

>NIGA_10350 membrane protein

>NIGA_10360 hypothetical protein

>NIGA_10370 hypothetical protein

>NIGA_10380 ABC transporter ATP-binding protein

>NIGA_10390 hypothetical protein

>NIGA_10400 hypothetical protein

>NIGA_10410 hypothetical protein

>NIGA_10420 hypothetical protein

>NIGA_10430 hypothetical protein

>NIGA_10440 multidrug ABC transporter ATP-binding and permease protein

>NIGA_10450 serine/threonine protein kinase

>NIGA_10460 hypothetical protein

>NIGA_10470 hypothetical protein

>NIGA_10480 hypothetical protein

>NIGA_10490 two-component system response regulator

>NIGA_10500 hypothetical protein

>NIGA_10510 hypothetical protein

>NIGA_10520 hypothetical protein

>NIGA_10530 hypothetical protein

>NIGA_10540 xanthine/uracil/vitamin C permease

>NIGA_10550 glutamine ABC transporter ATP-binding protein

>NIGA_10560 glutamine ABC transporter substrate-binding and permease protein

>NIGA_10570 deoxyadenosine kinase

>NIGA_10580 deoxynucleoside kinase

>NIGA_10590 hypothetical protein

>NIGA_10600 transglycosylase associated protein

>NIGA_10610 hypothetical protein

>NIGA_10620 hypothetical protein

>NIGA_10630 hypothetical protein

>NIGA_10640 hypothetical protein

>NIGA_10650 glucosamine-6-phosphate deaminase

>NIGA_10660 aldehyde oxidoreductase

>NIGA_10670 hypothetical protein

>NIGA_10680 hypothetical protein

>NIGA_10690 hypothetical protein

>NIGA_10700 hypothetical protein

>NIGA_10710 sugar ABC transporter permease protein

>NIGA_10720 branched-chain amino acid ABC transporter permease

>NIGA_10730 heme ABC transporter ATP-binding protein

>NIGA_10740 membrane protein

>NIGA_10750 hypothetical protein

>NIGA_10760 hypothetical protein

>NIGA_10770 serine/threonine protein kinase

>NIGA_10780 hypothetical protein

>NIGA_10790 hypothetical protein

>NIGA_10800 hypothetical protein

>NIGA_10810 hypothetical protein

>NIGA_10820 hypothetical protein

>NIGA_10830 hypothetical protein

>NIGA_10840 membrane protein

>NIGA_10850 hypothetical protein

>NIGA_10860 hypothetical protein

>NIGA_10870 Na+/H+ antiporter

>NIGA_10880 cation-transporting ATPase

>NIGA_10890 hypothetical protein

>NIGA_10900 hypothetical protein

>NIGA_10910 hypothetical protein

>NIGA_10920 D-Ala-teichoic acid biosynthesis protein

>NIGA_10930 D-alanine-activating enzyme DltA

>NIGA_10940 D-alanyl transfer protein DltB

>NIGA_10950 D-alanyl carrier protein DltC

>NIGA_10960 D-alanyl transfer protein DltD

>NIGA_10970 hypothetical protein

>NIGA_10980 hypothetical protein

>NIGA_10990 antimicrobial peptide ABC transporter ATP-binding and permease protein

>NIGA_11000 TetR family transcriptional regulator

>NIGA_11010 hypothetical protein

>NIGA_11020 hypothetical protein

>NIGA_11030 riboflavin synthase subunit alpha

>NIGA_11040 GTP cyclohydrolase II

>NIGA_11050 6,7-dimethyl-8-ribityllumazine synthase

>NIGA_11060 hypothetical protein

>NIGA_11070 hypothetical protein

>NIGA_11080 hypothetical protein

>NIGA_11090 cellobiose-specific PTS system IIC component

>NIGA_11100 acyltransferase

>NIGA_11110 haloacid dehalogenase

>NIGA_11120 glutamine amidotransferase

>NIGA_11130 drug/metabolite transporter permease

>NIGA_11140 hypothetical protein

>NIGA_11150 DNA invertase Pin

>NIGA_11160 hypothetical protein

>NIGA_11170 cold-shock protein

>NIGA_11180 hypothetical protein

>NIGA_11190 hypothetical protein

>NIGA_11200 hypothetical protein

>NIGA_11210 hypothetical protein

>NIGA_11220 hypothetical protein

>NIGA_11230 glutamine amidotransferase

>NIGA_11240 hypothetical protein

>NIGA_11250 hypothetical protein

>NIGA_11260 protein tyrosine/serine phosphatase

>NIGA_11270 hypothetical protein

>NIGA_11280 hypothetical protein

>NIGA_11290 serine/threonine protein kinase

>NIGA_11300 multidrug ABC transporter ATP-binding and permease protein

>NIGA_11310 tyrosine-protein phosphatase

>NIGA_11320 hypothetical protein

>NIGA_11330 macro domain protein

>NIGA_11340 hypothetical protein

>NIGA_11350 cytochrome C5

>NIGA_11360 hypothetical protein

>NIGA_11370 hypothetical protein

>NIGA_11380 hypothetical protein

>NIGA_11390 fumarate hydratase

>NIGA_11400 2-oxoglutarate translocator

>NIGA_11410 hypothetical protein

>NIGA_11420 dipeptidase

>NIGA_11430 citrate lyase regulator

>NIGA_11440 hypothetical protein

>NIGA_11450 hypothetical protein

>NIGA_11460 aminopeptidase N

>NIGA_11470 nitroreductase

>NIGA_11480 hypothetical protein

>NIGA_11490 cation-transporting ATPase

>NIGA_11500 hypothetical protein

>NIGA_11510 hypothetical protein

>NIGA_11520 hypothetical protein

>NIGA_11530 FAD/FMN-containing dehydrogenase

>NIGA_11540 TetR family transcriptional regulator

>NIGA_11550 antimicrobial peptide ABC transporter permease protein

>NIGA_11560 peptide ABC transporter ATP-binding protein

>NIGA_11570 hypothetical protein

>NIGA_11580 hypothetical protein

>NIGA_11590 transcriptional regulator

>NIGA_11600 FMN-binding protein

>NIGA_11610 hypothetical protein

>NIGA_11620 glucose specific PTS system IIA component

>NIGA_11630 hypothetical protein

>NIGA_11640 hypothetical protein

>NIGA_11650 ABC transporter ATP-binding protein

>NIGA_11660 hypothetical protein

>NIGA_11670 dipeptidase

>NIGA_11680 TetR family transcriptional regulator

>NIGA_11690 NADPH-dependent FMN reductase

>NIGA_11700 NADPH-dependent FMN reductase

>NIGA_11710 protein-tyrosine phosphatase

>NIGA_11720 thiamine biosynthesis lipoprotein

>NIGA_11730 CvpA family protein

>NIGA_11740 16S rRNA methyltransferase GidB

>NIGA_11750 chromosome partitioning protein ParB

>NIGA_11760 chromosome partitioning protein ParA

>NIGA_11770 chromosome partitioning protein ParB

>NIGA_11780 hypothetical protein

>NIGA_11790 GTP-binding protein YchF

>NIGA_11800 membrane protein

>NIGA_11810 hypothetical protein

>NIGA_11820 hypothetical protein

>NIGA_11830 multidrug ABC transporter ATP-binding and permease protein

>NIGA_11840 two-component system response regulator

>NIGA_11850 two-component system sensor histidine kinase

>NIGA_11860 UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase

>NIGA_11870 aspartate racemase

>NIGA_11880 DeoR family transcriptional regulator

>NIGA_11890 1-phosphofructokinase

>NIGA_11900 fructose-specific PTS system IIC component

>NIGA_11910 haloacid dehalogenase

>NIGA_11920 Mn/Zn ABC-type transport system ATP-binding protein

>NIGA_11930 Mn/Zn ABC-type transport system permease protein

>NIGA_11940 hypothetical protein

>NIGA_11950 L-lactate permease

>NIGA_11960 L-lactate oxidase

>NIGA_11970 oligoendopeptidase F

>NIGA_11980 hypothetical protein

>NIGA_11990 hypothetical protein

>NIGA_12000 alpha-amylase

>NIGA_12010 maltose phosphorylase

>NIGA_12020 beta-phosphoglucomutase

>NIGA_12030 glycerol-3-phosphate ABC transporter ATP-binding protein

>NIGA_12040 sugar ABC transporter substrate-binding protein

>NIGA_12050 sugar ABC transporter permease protein

>NIGA_12060 sugar ABC transporter permease protein

>NIGA_12070 alpha-glucosidase

>NIGA_12080 N-acetylglucosamine-6-phosphate deacetylase

>NIGA_12090 nucleoside deoxyribosyltransferase

>NIGA_12100 PTS sugar transporter IIA component

>NIGA_12110 protein tyrosine phosphatase

>NIGA_12120 universal stress protein UspA

>NIGA_12130 phosphonate ABC transporter substrate-binding protein

>NIGA_12140 phosphonate ABC transporter ATP-binding protein

>NIGA_12150 phosphonate ABC transporter permease protein

>NIGA_12160 phosphonate ABC transporter permease protein

>NIGA_12170 oligopeptide ABC transporter substrate-binding protein

>NIGA_12180 hypothetical protein

>NIGA_12190 serine/threonine protein phosphatase

>NIGA_12200 asparagine synthase

>NIGA_12210 carboxylate--amine ligase

>NIGA_12220 ribonucleoside-triphosphate reductase

>NIGA_12230 anaerobic ribonucleoside-triphosphate reductase activating protein

>NIGA_12240 hypothetical protein

>NIGA_12250 hemerythrin HHE cation binding domain protein

>NIGA_12260 major facilitator superfamily transporter

>NIGA_12270 hypothetical protein

>NIGA_12280 endopeptidase

>NIGA_12290 potassium transporter Kup

>NIGA_12300 hypothetical protein

>NIGA_12310 hypothetical protein

>NIGA_12320 hypothetical protein

>NIGA_12330 hypothetical protein

>NIGA_12340 N-acetylmuramidase

>NIGA_12350 putative amidase

>NIGA_12360 potassium transporter Kef

>NIGA_12370 oxidoreductase

>NIGA_12380 hypothetical protein

>NIGA_12390 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase

>NIGA_12400 LytR family transcriptional regulator

>NIGA_12410 membrane protein

>NIGA_12420 phosphoglycerol transferase

>NIGA_12430 hypothetical protein

>NIGA_12440 hypothetical protein

>NIGA_12450 tyrosyl-tRNA synthetase

>NIGA_12460 hypothetical protein

>NIGA_12470 zinc-ribbon domain-containing protein

>NIGA_12480 hypothetical protein

>NIGA_12490 phosphohydrolase

>NIGA_12500 hypothetical protein

>NIGA_12510 hypothetical protein

>NIGA_12520 hypothetical protein

>NIGA_12530 oligopeptide ABC transporter substrate-binding protein

>NIGA_12540 oligopeptide ABC transporter substrate-binding protein

>NIGA_12550 hypothetical protein

>NIGA_12560 hypothetical protein

>NIGA_12570 hypothetical protein

>NIGA_12580 oligopeptide ABC transporter substrate-binding protein

>NIGA_12590 oligopeptide ABC transporter permease protein

>NIGA_12600 oligopeptide ABC transporter permease protein

>NIGA_12610 oligopeptide ABC transporter ATP-binding protein

>NIGA_12620 oligopeptide ABC transporter ATP-binding protein

>NIGA_12630 hypothetical protein

>NIGA_12640 aminopeptidase C

>NIGA_12650 hypothetical protein

>NIGA_12660 aminopeptidase C

>NIGA_12670 small heat shock protein

>NIGA_12680 transcription elongation factor GreA

>NIGA_12690 adenylosuccinate synthetase

>NIGA_12700 GMP reductase

>NIGA_12710 excinuclease ABC subunit A

>NIGA_12720 hypothetical protein

>NIGA_12730 hypothetical protein

>NIGA_12740 xanthine permease

>NIGA_12750 xanthine phosphoribosyltransferase

>NIGA_12760 inosine-5'-monophosphate dehydrogenase

>NIGA_12770 GMP synthase

>NIGA_12780 hypothetical protein

>NIGA_12790 antitoxin HicB

>NIGA_12800 hypothetical protein

>NIGA_12810 hypothetical protein

>NIGA_12820 multidrug ABC transporter ATP-binding and permease protein

>NIGA_12830 AraC family transcriptional regulator

>NIGA_12840 6-phospho-beta-glucosidase

>NIGA_12850 hypothetical protein

>NIGA_12860 hypothetical protein

>NIGA_12870 amino acid ABC transporter substrate-binding protein

>NIGA_12880 amino acid ABC transporter ATP-binding protein

>NIGA_12890 glutamine ABC transporter permease protein

>NIGA_12900 hypothetical protein

>NIGA_12910 hypothetical protein

>NIGA_12920 hypothetical protein

>NIGA_12930 carboxylate--amine ligase

>NIGA_12940 putative transcriptional regulator

>NIGA_12950 amino acid permease

>NIGA_12960 homocysteine S-methyltransferase

>NIGA_12970 hypothetical protein

>NIGA_12980 MarR family transcriptional regulator

>NIGA_12990 L-asparaginase

>NIGA_13000 Cof-type HAD-IIB family hydrolase

>NIGA_13010 large-conductance mechanosensitive channel

>NIGA_13020 nicotinate phosphoribosyltransferase

>NIGA_13030 isochorismatase

>NIGA_13040 hypothetical protein

>NIGA_13050 hypothetical protein

>NIGA_13060 membrane protein

>NIGA_13070 NUDIX family hydrolase

>NIGA_13080 hypothetical protein

>NIGA_13090 hypothetical protein

>NIGA_13100 ABC-2 transporter family protein

>NIGA_13110 Mn/Zn ABC-type transport system ATP-binding protein

>NIGA_13120 hypothetical protein

>NIGA_13130 hypothetical protein

>NIGA_13140 hypothetical protein

>NIGA_13150 tryptophanyl-tRNA synthetase

>NIGA_13160 competence protein ComEB

>NIGA_13170 hypothetical protein

>NIGA_13180 magnesium-translocating P-type ATPase

>NIGA_13190 methionyl-tRNA synthetase

>NIGA_13200 TatD family hydrolase

>NIGA_13210 ribonuclease M5

>NIGA_13220 dimethyladenosine transferase

>NIGA_13230 Veg-like protein

>NIGA_13240 purine operon repressor

>NIGA_13250 bifunctional N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate acetyltransferase

>NIGA_13260 hypothetical protein

>NIGA_13270 ribose-phosphate pyrophosphokinase

>NIGA_13280 HD superfamily phosphohydrolase

>NIGA_13290 hypothetical protein

>NIGA_13300 DNA-directed RNA polymerase subunit delta

>NIGA_13310 CTP synthase

>NIGA_13320 UDP-N-acetylglucosamine 1-carboxyvinyltransferase

>NIGA_13330 type B 50S ribosomal protein L31

>NIGA_13340 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alani ne ligase

>NIGA_13350 DEAD/DEAH box helicase

>NIGA_13360 4'-phosphopantetheinyl transferase

>NIGA_13370 alanine racemase

>NIGA_13380 hypothetical protein

>NIGA_13390 peptidyl-tRNA hydrolase

>NIGA_13400 transcription-repair coupling factor

>NIGA_13410 hypothetical protein

>NIGA_13420 septum formation initiation protein

>NIGA_13430 RNA-binding protein

>NIGA_13440 tRNA(Ile)-lysidine synthetase

>NIGA_13450 cell division protein FtsH

>NIGA_13460 heat-shock protein Hsp33

>NIGA_13470 hypothetical protein

>NIGA_13480 oligopeptide ABC transporter substrate-binding protein

>NIGA_13490 peptidase T

>NIGA_13500 tRNA-dihydrouridine synthase

>NIGA_13510 lysyl-tRNA synthetase

>NIGA_13520 hypothetical protein

>NIGA_13530 hypothetical protein

>NIGA_13540 hypothetical protein

>NIGA_13550 O-acetylhomoserine aminocarboxypropyltransferase

>NIGA_13560 DeoR family transcriptional regulator

>NIGA_13570 GAF domain-containing protein

>NIGA_13580 ATP-dependent Clp protease ATP-binding protein

>NIGA_13590 hypothetical protein

>NIGA_13600 DNA-directed RNA polymerase subunit beta

>NIGA_13610 DNA-directed RNA polymerase subunit beta'

>NIGA_13620 hypothetical protein

>NIGA_13630 hypothetical protein

>NIGA_13640 30S ribosomal protein S12

>NIGA_13650 30S ribosomal protein S7

>NIGA_13660 elongation factor G

>NIGA_13670 30S ribosomal protein S10

>NIGA_13680 50S ribosomal protein L3

>NIGA_13690 50S ribosomal protein L4

>NIGA_13700 50S ribosomal protein L23

>NIGA_13710 50S ribosomal protein L2

>NIGA_13720 30S ribosomal protein S19

>NIGA_13730 50S ribosomal protein L22

>NIGA_13740 30S ribosomal protein S3

>NIGA_13750 50S ribosomal protein L16

>NIGA_13760 50S ribosomal protein L29

>NIGA_13770 30S ribosomal protein S17

>NIGA_13780 50S ribosomal protein L14

>NIGA_13790 50S ribosomal protein L24

>NIGA_13800 50S ribosomal protein L5

>NIGA_13810 30S ribosomal protein S14

>NIGA_13820 30S ribosomal protein S8

>NIGA_13830 50S ribosomal protein L6

>NIGA_13840 50S ribosomal protein L18

>NIGA_13850 30S ribosomal protein S5

>NIGA_13860 50S ribosomal protein L30

>NIGA_13870 50S ribosomal protein L15

>NIGA_13880 preprotein translocase subunit SecY

>NIGA_13890 adenylate kinase

>NIGA_13900 translation initiation factor IF-1

>NIGA_13910 30S ribosomal protein S13

>NIGA_13920 30S ribosomal protein S11

>NIGA_13930 DNA-directed RNA polymerase subunit alpha

>NIGA_13940 50S ribosomal protein L17

>NIGA_13950 energy-coupling factor transporter ATP-binding protein

>NIGA_13960 energy-coupling factor transporter ATP-binding protein

>NIGA_13970 energy-coupling factor transporter transmembrane protein

>NIGA_13980 tRNA pseudouridine synthase A

>NIGA_13990 50S ribosomal protein L13

>NIGA_14000 30S ribosomal protein S9

>NIGA_14010 hypothetical protein

>NIGA_14020 hypothetical protein

>NIGA_14030 oligopeptide ABC transporter substrate-binding protein

>NIGA_14040 NUDIX family hydrolase

>NIGA_14050 hypothetical protein

>NIGA_14060 hypothetical protein

>NIGA_14070 phosphatidylethanolamine-binding protein

>NIGA_14080 hypothetical protein

>NIGA_14090 aspartate aminotransferase

>NIGA_14100 membrane protein

>NIGA_14110 oligopeptide ABC transporter substrate-binding protein

>NIGA_14120 hypothetical protein

>NIGA_14130 hypothetical protein

>NIGA_14140 GntR family transcriptional regulator

>NIGA_14150 CDP-glycerol glycerophosphotransferase

>NIGA_14160 PST family polysaccharide transporter

>NIGA_14170 WecB/TagA/CpsF family glycosyl transferase

>NIGA_14180 glycosyl transferase

>NIGA_14190 glycosyl transferase

>NIGA_14200 NAD synthetase

>NIGA_14210 cation-transporting ATPase

>NIGA_14220 hypothetical protein

>NIGA_14230 hypothetical protein

>NIGA_14240 ABC transporter ATP-binding protein

>NIGA_14250 SprT family metallopeptidase

>NIGA_14260 membrane protein

>NIGA_14270 N-acetylmuramidase

>NIGA_14280 ATP-dependent DNA helicase PcrA

>NIGA_14290 DNA ligase

>NIGA_14300 hypothetical protein

>NIGA_14310 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C

>NIGA_14320 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit A

>NIGA_14330 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B

>NIGA_14340 diacylglycerol kinase

>NIGA_14350 membrane protein

>NIGA_14360 TrmA family RNA methyltransferase

>NIGA_14370 restriction endonuclease

>NIGA_14380 carbonic anhydrase

>NIGA_14390 hypothetical protein

>NIGA_14400 hypothetical protein

>NIGA_14410 hypothetical protein

>NIGA_14420 hypothetical protein

>NIGA_14430 cation-transporting ATPase

>NIGA_14440 copper chaperone

>NIGA_14450 hypothetical protein

>NIGA_14460 ArcR family transcriptional regulator

>NIGA_14470 hypothetical protein

>NIGA_14480 hypothetical protein

>NIGA_14490 hypothetical protein

>NIGA_14500 XRE family transcriptional regulator

>NIGA_14510 aspartate aminotransferase family protein

>NIGA_14520 hypothetical protein

>NIGA_14530 hypothetical protein

>NIGA_14540 major facilitator superfamily transporter

>NIGA_14550 antibiotic biosynthesis monooxygenase

>NIGA_14560 flavodoxin

>NIGA_14570 oxidoreductase

>NIGA_14580 hypothetical protein

>NIGA_14590 hypothetical protein

>NIGA_14600 hypothetical protein

>NIGA_14610 DNA-7-methylguanine glycosylase

>NIGA_14620 NUDIX family hydrolase

>NIGA_14630 hypothetical protein

>NIGA_14640 HNH endonuclease

>NIGA_14650 sugar O-acetyltransferase

>NIGA_14660 membrane protein

>NIGA_14670 AsnC family transcriptional regulator

>NIGA_14680 glucosamine-fructose-6-phosphate aminotransferase

>NIGA_14690 hypothetical protein

>NIGA_14700 mannitol-specific PTS system IIBC component

>NIGA_14710 mannitol-specific PTS system IIA component

>NIGA_14720 mannitol-1-phosphate 5-dehydrogenase

>NIGA_14730 phosphoenolpyruvate carboxylase

>NIGA_14740 ATPase component of ABC transporter with duplicated ATPase domains

>NIGA_14750 hypothetical protein

>NIGA_14760 major facilitator superfamily transporter

>NIGA_14770 membrane protein

>NIGA_14780 glutamate racemase

>NIGA_14790 dipeptidase

>NIGA_14800 glutamyl aminopeptidase

>NIGA_14810 energy-coupling factor transporter substrate-binding protein

>NIGA_14820 uridine kinase

>NIGA_14830 uridine kinase

>NIGA_14840 glutamine ABC transporter ATP-binding protein

>NIGA_14850 glutamine ABC transporter substrate-binding protein

>NIGA_14860 glutamine ABC transporter permease protein

>NIGA_14870 glutamine ABC transporter permease protein

>NIGA_14880 glutamine ABC transporter substrate-binding protein

>NIGA_14890 exopolyphosphatase

>NIGA_14900 polyphosphate kinase

>NIGA_14910 hypothetical protein

>NIGA_14920 hypothetical protein

>NIGA_14930 hypothetical protein

>NIGA_14940 hypothetical protein

>NIGA_14950 hypothetical protein

>NIGA_14960 ribokinase

>NIGA_14970 ribulose-5-phosphate 3-epimerase

>NIGA_14980 ribose-5-phosphate isomerase A

>NIGA_14990 nucleoside hydrolase

>NIGA_15000 GntR family transcriptional regulator

>NIGA_15010 phosphoketolase

>NIGA_15020 sortase family protein, LPXTG-site transpeptidase

>NIGA_15030 hemolysin-like protein

>NIGA_15040 hypoxanthine phosphoribosyltransferase

>NIGA_15050 amino acid permease

>NIGA_15060 1,4-beta-N-acetylmuramidase

>NIGA_15070 DEAD/DEAH box helicase

>NIGA_15080 cellobiose-specific PTS system IIC component

>NIGA_15090 hypothetical protein

>NIGA_15100 uracil transporter

>NIGA_15110 aluminum resistance protein

>NIGA_15120 ornithine decarboxylase

>NIGA_15130 hypothetical membrane protein

>NIGA_15140 amino acid permease

>NIGA_15150 hypothetical protein

>NIGA_15160 UDP-N-acetylglucosamine 2-epimerase

>NIGA_15170 cell wall teichoic acid glycosylation protein

>NIGA_15180 flavodoxin

>NIGA_15190 methionine aminopeptidase

>NIGA_15200 ribonuclease BN

>NIGA_15210 UTP--glucose-1-phosphate uridylyltransferase

>NIGA_15220 hypothetical protein

>NIGA_15230 alpha/beta hydrolase

>NIGA_15240 TrmA family RNA methyltransferase

>NIGA_15250 regulatory protein RecX

>NIGA_15260 hypothetical protein

>NIGA_15270 hypothetical protein

>NIGA_15280 hemolysin-like protein

>NIGA_15290 peptide chain release factor 3

>NIGA_15300 hypothetical protein

>NIGA_15310 multicopper oxidase

>NIGA_15320 hypothetical protein

>NIGA_15330 ATP-dependent Clp protease ATP-binding protein

>NIGA_15340 hypothetical protein

>NIGA_15350 phosphocarrier protein HPr

>NIGA_15360 phosphoenolpyruvate-protein phosphotransferase

>NIGA_15370 arsenate reductase

>NIGA_15380 adapter protein MecA

>NIGA_15390 competence protein CoiA

>NIGA_15400 dithiol-disulfide isomerase

>NIGA_15410 adenylate cyclase

>NIGA_15420 GTP pyrophosphokinase

>NIGA_15430 ATP-NAD kinase

>NIGA_15440 ribosomal large subunit pseudouridine synthase D

>NIGA_15450 hypothetical protein

>NIGA_15460 UDP pyrophosphate phosphatase

>NIGA_15470 hypothetical protein

>NIGA_15480 hypothetical protein

>NIGA_15490 hypothetical protein

>NIGA_15500 glucitol/sorbitol-specific PTS system IIA component

>NIGA_15510 membrane protein

>NIGA_15520 RNA methyltransferase

>NIGA_15530 transposase

>NIGA_15540 cell division protein FtsK

>NIGA_15550 peptidase M16

>NIGA_15560 peptidase M16

>NIGA_15570 3-oxoacyl-ACP reductase

>NIGA_15580 transcriptional regulator

>NIGA_15590 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase

>NIGA_15600 recombinase RecA

>NIGA_15610 ribonuclease

>NIGA_15620 UDP-phosphate N-acetyl-glucosaminyl transferase

>NIGA_15630 YigZ family protein

>NIGA_15640 competence protein ComFA

>NIGA_15650 competence protein ComFC

>NIGA_15660 ribosomal subunit interface protein

>NIGA_15670 preprotein translocase subunit SecA

>NIGA_15680 peptide chain release factor 2

>NIGA_15690 hypothetical protein

>NIGA_15700 HPr kinase/phosphorylase

>NIGA_15710 diacylglyceryl transferase

>NIGA_15720 glycerol-3-phosphate dehydrogenase

>NIGA_15730 thioredoxin reductase

>NIGA_15740 excinuclease ABC subunit B

>NIGA_15750 excinuclease ABC subunit A

>NIGA_15760 membrane protein

>NIGA_15770 hypothetical protein

>NIGA_15780 hypothetical protein

>NIGA_15790 P1 family peptidase

>NIGA_15800 ATPase P

>NIGA_15810 hypothetical protein

>NIGA_15820 sporulation regulator WhiA

>NIGA_15830 ATP-dependent Clp protease proteolytic subunit

>NIGA_15840 hypothetical protein

>NIGA_15850 ABC transporter substrate-binding protein

>NIGA_15860 branched-chain amino acid ABC transporter permease protein

>NIGA_15870 ABC transporter ATP-binding protein

>NIGA_15880 central glycolytic genes regulator

>NIGA_15890 glyceraldehyde-3-phosphate dehydrogenase

>NIGA_15900 phosphoglycerate kinase

>NIGA_15910 triosephosphate isomerase

>NIGA_15920 GNAT family acetyltransferase

>NIGA_15930 hypothetical protein

>NIGA_15940 haloacid dehalogenase

>NIGA_15950 uracil-DNA glycosylase

>NIGA_15960 phosphotransacetylase

>NIGA_15970 tRNA threonylcarbamoyladenosine biosynthesis protein TsaE

>NIGA_15980 DNA polymerase III subunit epsilon

>NIGA_15990 UDP-N-acetylenolpyruvoylglucosamine reductase

>NIGA_16000 spermidine/putrescine ABC transporter ATP-binding protein

>NIGA_16010 spermidine/putrescine ABC transporter permease protein

>NIGA_16020 spermidine/putrescine ABC transporter permease protein

>NIGA_16030 spermidine/putrescine ABC transporter substrate-binding protein

>NIGA_16040 membrane protein

>NIGA_16050 hypothetical protein

>NIGA_16060 phosphoglucosamine mutase

>NIGA_16070 sugar phosphate phosphatase

>NIGA_16080 serine hydrolase

>NIGA_16090 CopY/TcrY family copper transport repressor

>NIGA_16100 copper-binding protein

>NIGA_16110 cation-transporting ATPase

>NIGA_16120 chromosome condensation protein CrcB

>NIGA_16130 camphor resistance protein CrcB

>NIGA_16140 hypothetical protein

>NIGA_16150 signal transduction diguanylate cyclase

>NIGA_16160 hypothetical protein

>NIGA_16170 protein-tyrosine phosphatase

>NIGA_16180 NAD-dependent dehydratase

>NIGA_16190 amino acid permease

>NIGA_16200 peptide methionine sulfoxide reductase

>NIGA_16210 serine protease

>NIGA_16220 metal ABC transporter substrate-binding protein

>NIGA_16230 membrane protein

>NIGA_16240 transcriptional regulator

>NIGA_16250 competence protein ComGA

>NIGA_16260 competence protein ComGB

>NIGA_16270 competence protein ComGC

>NIGA_16280 hypothetical protein

>NIGA_16290 competence protein ComGF

>NIGA_16300 hypothetical protein

>NIGA_16310 adenine-specific DNA methylase

>NIGA_16320 acetate kinase

>NIGA_16330 hypothetical protein

>NIGA_16340 two-component system response regulator

>NIGA_16350 two-component system sensor histidine kinase

>NIGA_16360 alkaline phosphatase

>NIGA_16370 glycopeptide antibiotics resistance protein

>NIGA_16380 glucose-6-phosphate isomerase

>NIGA_16390 hypothetical protein

>NIGA_16400 hypothetical protein

>NIGA_16410 serine hydrolase

>NIGA_16420 hypothetical protein

>NIGA_16430 UDP-N-acetylmuramyl peptide synthase

>NIGA_16440 thymidine kinase

>NIGA_16450 peptide chain release factor 1

>NIGA_16460 N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase

>NIGA_16470 translation factor Sua5

>NIGA_16480 uracil phosphoribosyltransferase

>NIGA_16490 F0F1 ATP synthase subunit A

>NIGA_16500 F0F1 ATP synthase subunit C

>NIGA_16510 F0F1 ATP synthase subunit B

>NIGA_16520 F0F1 ATP synthase subunit delta

>NIGA_16530 F0F1 ATP synthase subunit alpha

>NIGA_16540 F0F1 ATP synthase subunit gamma

>NIGA_16550 F0F1 ATP synthase subunit beta

>NIGA_16560 F0F1 ATP synthase subunit epsilon

>NIGA_16570 membrane protein

>NIGA_16580 rod shape-determining protein MreB

>NIGA_16590 hypothetical protein

>NIGA_16600 hypothetical protein

>NIGA_16610 rod shape-determining protein RodA

>NIGA_16620 universal stress protein UspA

>NIGA_16630 hypothetical protein

>NIGA_16640 recombination factor protein RarA

>NIGA_16650 hypothetical protein

>NIGA_16660 30S ribosomal protein S4

>NIGA_16670 septation ring formation regulator EzrA

>NIGA_16680 cysteine desulfurase

>NIGA_16690 thiamine biosynthesis protein ThiI

>NIGA_16700 ribosomal small subunit pseudouridine synthase A

>NIGA_16710 valyl-tRNA synthetase

>NIGA_16720 folylpolyglutamate synthase

>NIGA_16730 beta-phosphoglucomutase

>NIGA_16740 DNA repair protein RadC

>NIGA_16750 rod shape-determining protein MreB

>NIGA_16760 rod shape-determining protein MreC

>NIGA_16770 rod shape-determining protein MreD

>NIGA_16780 hypothetical protein

>NIGA_16790 cell division protein MraZ

>NIGA_16800 16S rRNA (cytosine(1402)-N(4))-methyltransferase

>NIGA_16810 cell division protein FtsL

>NIGA_16820 penicillin-binding protein 2B

>NIGA_16830 phospho-N-acetylmuramoyl-pentapeptide transferase

>NIGA_16840 UDP-N-acetylmuramoylalanine--D-glutamate ligase

>NIGA_16850 UDP-N-acetylglucosamine--N-acetylmuramyl-(pentape ptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase

>NIGA_16860 cell division protein FtsQ

>NIGA_16870 cell division protein FtsA

>NIGA_16880 cell division protein FtsZ

>NIGA_16890 cell division protein SepF

>NIGA_16900 cell division membrane protein

>NIGA_16910 S4-like RNA binding protein

>NIGA_16920 isoleucyl-tRNA synthetase

>NIGA_16930 cold-shock protein

>NIGA_16940 ADP-ribose pyrophosphatase

>NIGA_16950 hypothetical protein

>NIGA_16960 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase

>NIGA_16970 cysteine desulfurase

>NIGA_16980 cysteine desulfurase

>NIGA_16990 tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase

>NIGA_17000 phosphoglycerate mutase

>NIGA_17010 hypothetical protein

>NIGA_17020 exodeoxyribonuclease V subunit alpha

>NIGA_17030 pyruvate dehydrogenase complex E3 component dihydrolipoamide dehydrogenase

>NIGA_17040 ribonuclease J

>NIGA_17050 hypothetical protein

>NIGA_17060 peptide deformylase

>NIGA_17070 GTP-binding protein TypA

>NIGA_17080 cell division protein FtsW

>NIGA_17090 hypothetical protein

>NIGA_17100 rRNA methyltransferase

>NIGA_17110 phosphopantetheine adenylyltransferase

>NIGA_17120 hypothetical protein

>NIGA_17130 competence protein ComEA

>NIGA_17140 competence protein ComEC

>NIGA_17150 DNA polymerase III subunit delta

>NIGA_17160 30S ribosomal protein S20

>NIGA_17170 30S ribosomal protein S15

>NIGA_17180 RNase J family beta-CASP ribonuclease

>NIGA_17190 hypothetical protein

>NIGA_17200 translation elongation factor Tu

>NIGA_17210 trigger factor

>NIGA_17220 ATP-dependent Clp protease ATP-binding subunit ClpX

>NIGA_17230 GTP-binding protein

>NIGA_17240 hypothetical protein

>NIGA_17250 hypothetical protein

>NIGA_17260 nitroreductase

>NIGA_17270 oligopeptide ABC transporter substrate-binding protein

>NIGA_17280 hypothetical protein

>NIGA_17290 D-lactate dehydrogenase

>NIGA_17300 thymidylate synthase

>NIGA_17310 dihydrofolate reductase

>NIGA_17320 cation-transporting ATPase

>NIGA_17330 methionine ABC transporter substrate-binding protein

>NIGA_17340 methionine ABC transporter ATP-binding protein

>NIGA_17350 methionine ABC transporter permease protein

>NIGA_17360 fumarate reductase flavoprotein subunit

>NIGA_17370 hypothetical protein

>NIGA_17380 hypothetical protein

>NIGA_17390 hypothetical protein

>NIGA_17400 hypothetical protein

>NIGA_17410 aminotransferase

>NIGA_17420 LysR family transcriptional regulator

>NIGA_17430 arginyl-tRNA synthetase

>NIGA_17440 arginine repressor

>NIGA_17450 phosphopantothenoylcysteine decarboxylase / phosphopantothenate-cysteine ligase

>NIGA_17460 hypothetical protein

>NIGA_17470 hypothetical protein

>NIGA_17480 hypothetical protein

>NIGA_17490 hypothetical protein

>NIGA_17500 hypothetical protein

>NIGA_17510 hypothetical protein

>NIGA_17520 hypothetical protein

>NIGA_17530 2-hydroxyacid dehydrogenase

>NIGA_17540 ATP-dependent DNA helicase RecQ

>NIGA_17550 inosine-uridine preferring nucleoside hydrolase

>NIGA_17560 excinuclease ABC subunit C

>NIGA_17570 GTPase Obg

>NIGA_17580 acyltransferase

>NIGA_17590 ribonuclease Z

>NIGA_17600 short-chain dehydrogenase

>NIGA_17610 50S ribosomal protein L32

>NIGA_17620 2', 3'-cyclic nucleotide 2'-phosphodiesterase

>NIGA_17630 hypothetical protein

>NIGA_17640 hypothetical protein

>NIGA_17650 hypothetical protein

>NIGA_17660 hypothetical protein

>NIGA_17670 hypothetical protein

>NIGA_17680 hypothetical protein

>NIGA_17690 hypothetical protein

>NIGA_17700 gamma-glutamyl phosphate reductase

>NIGA_17710 glutamate 5-kinase

>NIGA_17720 hypothetical protein

>NIGA_17730 DNA polymerase III subunit alpha

>NIGA_17740 6-phosphofructokinase

>NIGA_17750 pyruvate kinase

>NIGA_17760 predicted acyltransferase

>NIGA_17770 S1 RNA-binding protein

>NIGA_17780 tyrosine recombinase XerD

>NIGA_17790 hypothetical protein

>NIGA_17800 segregation and condensation protein ScpA

>NIGA_17810 segregation and condensation protein ScpB

>NIGA_17820 ribosomal large subunit pseudouridine synthase B

>NIGA_17830 membrane protein

>NIGA_17840 N-acetylmuramidase

>NIGA_17850 cytidylate kinase

>NIGA_17860 30S ribosomal protein S1

>NIGA_17870 GTP-binding protein EngA

>NIGA_17880 DNA-binding protein HU

>NIGA_17890 peptide-binding protein

>NIGA_17900 membrane protein

>NIGA_17910 LysR family transcriptional regulator

>NIGA_17920 hypothetical protein

>NIGA_17930 hypothetical protein

>NIGA_17940 hypothetical protein

>NIGA_17950 hypothetical protein

>NIGA_17960 hypothetical protein

>NIGA_17970 hypothetical protein

>NIGA_17980 hypothetical protein

>NIGA_17990 transcriptional regulator

>NIGA_18000 LysR family transcriptional regulator

>NIGA_18010 argininosuccinate synthase

>NIGA_18020 argininosuccinate lyase

>NIGA_18030 hypothetical protein

>NIGA_18040 hypothetical protein

>NIGA_18050 hypothetical protein

>NIGA_18060 hypothetical protein

>NIGA_18070 hypothetical protein

>NIGA_18080 hypothetical protein

>NIGA_18090 GTP pyrophosphokinase

>NIGA_18100 two-component system response regulator

>NIGA_18110 two-component system sensor histidine kinase

>NIGA_18120 CRISPR-associated helicase/endonuclease Cas3

>NIGA_18130 CRISPR-associated protein Cas5

>NIGA_18140 CRISPR-associated protein Csd1

>NIGA_18150 CRISPR-associated protein

>NIGA_18160 hypothetical protein

>NIGA_18170 hypothetical protein

>NIGA_18180 CRISPR-associated protein Cas1

>NIGA_18190 CRISPR-associated protein Cas2

>NIGA_18200 acetyl-CoA acetyltransferase

>NIGA_18210 3-hydroxy-3-methylglutaryl-CoA reductase

>NIGA_18220 hydroxymethylglutaryl-CoA synthase

>NIGA_18230 membrane protein

>NIGA_18240 prolyl-tRNA synthetase

>NIGA_18250 ribosomal protein L11 methyltransferase

>NIGA_18260 GTP pyrophosphokinase

>NIGA_18270 tyrosyl-tRNA deacylase

>NIGA_18280 histidyl-tRNA synthetase

>NIGA_18290 aspartyl-tRNA synthetase

>NIGA_18300 hypothetical protein

>NIGA_18310 hypothetical protein

>NIGA_18320 membrane protein

>NIGA_18330 3-oxoacyl-ACP synthase 3

>NIGA_18340 acyl carrier protein

>NIGA_18350 ACP S-malonyltransferase

>NIGA_18360 3-oxoacyl-ACP reductase

>NIGA_18370 3-oxoacyl-ACP synthase 2

>NIGA_18380 acetyl-CoA carboxylase, biotin carboxyl carrier protein

>NIGA_18390 3-hydroxyacyl-ACP dehydratase

>NIGA_18400 acetyl-CoA carboxylase, biotin carboxylase subunit

>NIGA_18410 acetyl-CoA carboxylase, carboxyl transferase subunit beta

>NIGA_18420 acetyl-CoA carboxylase, carboxyl transferase subunit alpha

>NIGA_18430 enoyl-ACP reductase 1

>NIGA_18440 biotin-[acetyl-CoA-carboxylase] ligase

>NIGA_18450 hypothetical protein

>NIGA_18460 hypothetical protein

>NIGA_18470 formate/nitrite transporter

>NIGA_18480 bifunctional acetaldehyde-CoA/alcohol dehydrogenase

>NIGA_18490 hypothetical protein
ATGGAGAAGACCGTGTTAGACAAAATCCGAGCCTTCGTATCCCTGGCCGGCAACCTGAATTTTTCCCGGACAGCCGATGAGCTGTATACCAGCCAAAGTACGGTTTCCAAGCATATCGCTGCCTTAGAAAAATAG
>NIGA_18500 hypothetical protein
ATGAAGCTGTTTGAAAGAAGCAGCCGCCGAGTTCGCCTGACCCGGGAGGGGGAGTACCTGCTCCCTTATGCCCAGCGTCTCTTAGCAGACAGCCGGCAGTTTGACCAGGCAGCCGCGGCCTGCCGGCAAGAGCAGACCAAGACCCTGGACCTGTACGCGATCCCCACCATGACCAATTACGATTTTTTCAAGGCCGTAAACCGCCTTTATGGGCCGGCATCCGGAGATCGACCTGCTTTTTCATGA
>NIGA_18510 hypothetical protein
GTGAAATTGGCCGACCTGGCTGGAGCCCGTTTTTTGACCTTGGGTGAACGGACTTATTTCGAGAAGAAAATTGTTGCTGCCTGCCAAAAAGCTGGTTATGAACCCAATTTCGTCTACCAGGGTGAACGGATCGAGGCAATTTTAGAAATGGTCCGCCAGCAGCTGGGCATTGCTCTTTTGATGAAAAAATCTGTTTCTGATAGCCAGCTAGCTGGTTTAAAGCGACTGGACTTGGCAGAGAGCTACTAA
>NIGA_18520 hypothetical protein
ATGGGGGCAACCAGCAGCACGCAAGCTAGCGCCGACTACCTCGCTGCTCCTTTGACCAACGGCTTCCTGCAGGGCTACAACACCCTGGACGCCCTGGCAGCTTTGGACTTCGGGATTACGGTTGTTACGGCCATCAAGGGCTTCAAGATCAAGGAAGGCAAGGAAACTTCCCTGGCCCTGGCCAAGACTGGTGCCATCGGTTTTGCCGGCATCGCCATCATCTACCTTATCCTTATCCTGGTTGCCCTGGGCGCCGGCAGCCTGCACTACTTCAAATTGTCTGAAAACGGCGGGATTGCTTTTGCCCAAATCGTCCACCACTACCTGGGCACTTTCGGGGAAGCCCTCCTGGCGACCTTGGCTACCATCACCTGCATGTCCACGGCCATCGGCCTGGTAGTTGCCTTTGCCCAGGACTCCCACAAGCGTTTTCCAAAAATTTCCTACCGGACTTTCCTGACCTTTAACTGCCTGCTTTCATTTGCCATTGCCAACTTTGGCTTGACCACTATCATCGCCTGGTCAACTCCGGTTTTGATGTTCCTCTACCCCCTGGCCATTGCCTTGATCTTCTGCGGCTTGACCAGCAATTTTTTCAATAATGATACGGCAGTTTACAAGTTTGTGGTTTACTTTACGATTATTCCGGCCATATTTGACGGCTTGAACGCGTCCCCAAGCATTATTAGCAATACTGCTTTTGCTAAGGCTGCCCTGACCTTTGCCGGCCGTTACCTGCCACAAAAAATACAGCGTGAAAGCAAATTAAGCTTTCACGCTGTTTCTTTTTACTCATATTCAAAAAATTCGGCTGGAAAGGGCTGCCGCAGATGTCCTTGCGGCCGTTCTTTTTAA
>NIGA_18530 transposase
ATGAATGCTAATACGGCAGCCGCCGTCAACATTCTGCGCAGAGCGGATGATAAGAACATCACGCTCTACACGCCATACAAAAAAGTTGAGAAGATTCTTGAAGATCGTTATGCAAATAAGCAGTCAGTGATGGCATAG
>NIGA_18540 transposase
ATGAACCTCAATTCGATGTGGACCAATCTCGGTCTGAAACTGAAGAAAATCGTTCAGGCCAATGAGTCGCTGGCAAAGGAAGAACGCCAGTATCTCAACTACGTCTTCACTGCATCATATTACTGGCAGCTCATTCTGCAGGGACGCGAAAATGAGGCAGAGTCAAGTAAGGAAAGCAAGTATCCTGTACTGAGAGTGGCTTTGACGAAAGATCAGCTTCGCCACTGCTTTGGATACATCAGGTGTCTTACCAGAAAGTATAAGCCATATCCACATTCATCAGCCGCTCGCTGCATGCTCTATGACGAAATAATGTGGAAAGTCATTCAAAAAGACGGCGCTGACCATTTGGATATCATGACAGCCGTATCAGGCAAAAGAAAGCAGCTCAAGCTGACGGGGCCATTCTGCTATGCCAACAAGAAAAAGCGCGGCGATGTCCAGCTGATCCTCGACCGGGATAAGAAGCGTCTGGAAGTCCATCGCGCTATCAAGGCTGCTGTCCATGATCTGCACAAAAGCAAAAAGAAGAAAGTCGGCATGGACAAAGGGCTGGCAACGCTTCTGTCGTGCAGCAGCGGTCATGAGTACGGCTTCAATTTCAGCCAGCTCGTGAATGCCGAGGTTGAACGGATAAATCGGCGCAATACCAACCGCAACGAGTACATTCAGGCAGCCAAAGAGCTGAGACATGAGCTGTCTGCTCTGCAAGCAAAGCTGGCCATCAAGCATTCGGCCAAGACTGAGCGGCGGCTTAGAAACCGCATTGGCAGTCTTGAGCGCCGCATCAGCCGCTTGGAAGAACGCCATCTGGGCAGCAAGCTCTATCACCGCCAGCATGCACGAAAGCAGTGCAACATGGAACGAATAATGAATATGAGCATCAGAAAGATGCTCCTGACTGAAAAGCCGGATGTTCTGGTCAAGGAGGACCTGAGCTTCACCAAAGAAAACTGCCCAAAGCGGCGAACCGCTATGAAGCGAAGGTTAGACGCAAGCTGTCCTCGTGGACCAAAGGCACGCTGGACGATCGTATCGAATACCTTTGTGATTGCCTGGGGATTCGGACGGTTGATGTCAACCCGGCATATACCTCTCAGTTCTGTCCGAATTGTGGAGCCCGCTTTAGCGAAAGGAAAGGCACCCACCATGAATTAA
>NIGA_18550 hypothetical protein
ATGACAAGAAGGAAACTAAGGACTCAAATTAAGACGATCAGAGCTTACACGGTACGATTGAGCGATGACGAGCTGCAGGAACTGGATAAGCTGTTCAACAACTACGGCAGATGCCGTGATCTGCTTTATGGTCAGCTGTGCGGAATCAACCACATGACCGACGTTGAAAATTGGCGTGGCCCAAGGGACAGAATCCGTCAGCACGAAGGCAAAATAAAGCAGGCTCGCAAGGCTGTCAGAAGCTGGAAGAAAGCTTATGCCGAAAACAAGACTCAAAACATGAAGGTACCGGATTCTGGAACGGTCAGACTTGCAAGGCAAAAGCTCCTGAATGAGCAGTTTCATATTTAA
>NIGA_18560 hypothetical protein
ATGGCTGAAGAGTATCTTGGCATCAAAGACGCCGCAAAATATCTGAAAGTCTCAATTTCAACGCTGAGACGCTGGGAAAAGAAAGGCCTCATTACTCCAATGAGAACAGCCGGCAATCGTCGGAGATATACAGTCCGACAGCTGGACGACATGCTTGGGCTCAATACTCAGAAAGAGCTTGGAGCAGTTGCCAGACGCGGCCTCGTTATTGGCTATTGCCGCGTGTCATCTTCAGGCCAAAAGGCCGACCTTGAGAGACAGGCTGAGGTCGTTGCCAACTACTGCGAAAAGCAGGGCTATCAGTTTCGGATCATCAAGGACATTGGCTCCGGAATGAATTATAAGAAAAAAGGCCTGCAGGAGCTTTTGAGACTTGTTTGCGAAGGCGGCTGCAGCAAGATAGTCGTCAACTACAAAGACAGGCTCGTCCGTTTCGGCTATGAGCTGATTGAGACGGTCTGTGAGGAACACAACGTAGATATCGAAATTATCAATCAGACTGACGACATCTCCTACGAAGAAGAACTGACGGAAGACGTACTGGCAATCATCACCGTGTTCTCTGCCAAGCTGTATGGCAAGCGGAGTCACCGCAATGAGCAGATTGTCGCGGAAAACAGAAAGCTGTTCTCAAAAGATGACAAGAAGGAAACTAAGGACTCAAATTAA
>NIGA_18570 regulatory protein, MerR:Resolvase, N-terminal protein
TTGATAGAACAACAGGATAAACTATTTGAGGATGAAGATGCTCGAGAAATTTTAGCTCAACTTTATAGGTATCATCCAAGAGCTTTGAGATTGCCTATGCAAAATCAAAAGGTATTGTTATTAGAACAATGTCAACTTATTACAAAAGCTACTAGTCAAGCCGTGGTAGATATGACTGATCCAAGATTTCCGTATGTACTTCAGCCGGAAGCAGAGCAGAGAATAAAAAAAGAATTAGCTGCTGAGAAACCAAAATAA
>NIGA_18580 hypothetical protein
ATGTTAGACAAGACTAAACAAATTTGGTTTATTGGGATCAAGGGGACCGGGATGGCTTCCTTGGCCTTGATTTTGCACGACCTGGGCTACAAGGTTGCCGGCAGCGACATCGACAAGTACACCTTCACCCAGGATCCGCTGGAAGCAGCTGGGATTGAAGTTGCTTCCTTCTCCAAGGACAACATCAAGGGAAGCGGCCAGGTGATCGTCAAGGGCAACGCCTTTAAGAGCGATAACATCGAAGTTGCCGCCTGCGAGGAAAAGGGCGTGGCGTGGCAAAGCTACCCGGACACGGTTGAAGAAATCGTCCAGCAGTACACCAGTATCGGGGTTGCGGGTTCCCACGGCAAGACTTCAACCACCGGCCTTTTGGCAACGGTTTTGGGCGAAGCCGCTCCGACTTCCTTCCTGATCGGTGACGGGATGGGGAAGGGGGTCAAGGATTCCCGCTTCTTCGTCTACGAAGCTGACGAATACCGGCGGCACTTCCTGGCCTACCACCCGGACTACCAGATCATGACCAATGTTGACTTTGACCACCCTGACTACTTCAAGGACAGAGACGACTATGCCTCAGCCTTCCAGACGGCGGCTGACCAGACTAAGAAGGGGCTTTTTGTCTGGGGCGATGACGAACGCCTGCAGAAGATCCAGCCAAAGACGGCCAAGAAGTACACTTACGGCTTGAAAGACAGCGATGACTTCCAGGCCTTTGACGTGGTTAAGACCACTGAAGGGGCCAAGTTCCATGTCCGGGCCCAGGGGAAAGACTTAGGCGAATTCACCATCCACCTTTTCGGTGACCATAATGTGATGAACGCCACGGCGGTTATTGCCATTGCCTTTACTGAAGGCATCGACCTTGATGTAGTCAGAAAGGGTCTGGTCAAGTACACCGGGGCCAAGCGCCGCTTCAGCGAAAAGGACTTTGGTGACACGGTGGTCATCGATGACTACGCCCACCACCCAACTGAACTGCGGGCTACGATTCAAGCTGCCCGGCAGAAGTTCCCGGACCGGAAGCTGGTTACCATCTTCCAGCCGCACACTTACTCCAGAACCAAGGAATTCGAAGAAGAATACGTGGAAATTCTGAAGGGGGTCGACAAGGCCTTCTTGACGCCAATTTACGGGTCAGCCAGAGAAGTAGCGGGCGACATCAAGAGTGAAGACATCACCAGCCAGATTCCAGGCGCTGAAGTCATTGACTTCGACAATCTGAAGGATCTTTTGGCTTACAAGGGTGACTGCATTGTCTTCATGGGTGCCGGCGATATTCCTAAATATGAAGTAGCATTTGAAGAAATGCTGGAAAAGTAA
>NIGA_18590 serine hydrolase
TTGTTCAAAAAAGGTAAGAAATTAATCGTTGCCCTGCTTGTCTTAGTGGCCGCTTTGGCGTTTTGGCCAGAAGAAACCGCCCCTGATCTGGTAACGGCGGCCGATATGCATGTTTTTGTCGAGAAGCTTTTTAAGAAGAAGCATGTGACCGGCAGCGTGGCTATAGTGCAAAACGGGCATGTCCAGGTTGTTAACTATGGCTTGGCTAATGCTAAGCAGAAGGTCAAGAACGGGGCCAGCCAGGTCGTCTACCCGGCCGCTTCCATGCAAAAGGAAGTTACCGGGGCCATGATCATGCAGCTGATGGAAGAAAAGAAGGGGAGCTCAAGTGCTTTTAGTCAAAACACGAAGATCTCTCGCTGGTACCCGGCCTTGCGGAATGCCAAGAAAATCAGCGTGGGCAACTTGCTTTCCCACACTTCAGGCTTGCAGATTCCGGAAGTCGAAGCCGACCGCCATATCAACTACAGTGAAGACCAGGCAGTAAACTGGATTGTGAACCGGGCCAACCAATTGCCGCAGGACAAGGTGGGGAGCTACCACTACAGCGACGTCAATTATGTTTTGCTGGCAGGCATCATCAAGAAGGTGAGCCATAAGTCATACGCCTGGAACTTTAAGAAGCGGGTGGTCCAGCGGCTGGGCCTCAAGTCAACTTATGTAAGCAACCAGCTGCCTAAGAATAAGATGCTGGCTGTATCTTACGCCTATAAGCATGGCAAGAACTACCAGCAGGCGGCAATTTTGGAAAAGACACGGTTGTCTCAGCTGGTTGGGGCCGGGAACATGCTGACGACAGCCAGCGACTACTATCTTATCCAAGAAGCTTTGGGGACAGGGCAGTTCCTGTCGCCGAGCGCCTTTCACAAGCTGACCCACCTCAAGAGCAAGATCAACCAATATAGCGGCGGGGTTTACCTCAAGAAGGGGGAAAAGGTCAAGCTGGCCTACGGGGCAATTGGCAGCGCCCACTATGCTGCTTACTTCCAGCTGACAGCTGACAACAAGAACGGGATTATCCTGCTTCTCAACCAGCGCAGCTTTGGTGAAGACAAGGTCAAGGATATTGGCTACCAGATCTTGAAAGAGATCAGGTTTGCTACTTTCTCTAAGAATTAA
>NIGA_18600 UDP-N-acetylmuramate--L-alanine ligase
ATGACCAGTATCGCTGAAGAGAATGGTGTATCAGTTACTACTGTGCAAAGATACTTAGACCACTGCAGCGCTCAATTTACTCCTTCATTCGATTCTTTGCCAGAACACTTAGCGTTTGATGAATTTAGAGGTGTGGGGCGAAAGCTGCACTTTATCTGTCAAGATGGCGAAAAACATACTATCGTCGCCATTTTAGAGAATTGCTTCAAAAACACTATTATTAAATACTTTTTGCAGTTCCCGGAAATAGTTAGAAAGACTGTCAGAACAGTAAGTATGGACCTCAACTGCTACTACGGTGATATTGTGCGTCAGATTTTCCCAAACGCCGAGCTTGTCATTGACCGTTTCCATATGGTTCAAATGGTAAACAGATCCTTTATCGGTTTTAGAGTTCAAGTCATGAAACAGTAG
>NIGA_18610 serine hydrolase
ATGAACCCTACTGCTAATTATATTGAAAACTTGCTTAATGTTAAAGACCCTTGCCTAAATTTTGTAGATTGCTCTCAAACAACTTACAAGGGGAGAAAAGTAATCATGTGTACAGCCATTGTACCCAAATCGTTGACAAGTATTGCCACATCTCTAACGCCGTTAAACGTAAGATCATTGTCGGACTCACTAAAGATCATTCTATGA
>NIGA_18620 rRNA methyltransferase
ATGGACAGAATCGACAGAGAAAACAATCTGATCAGAATTAACGCTTTCGATGATCCCAGACTAAAGCTGTTTACTGATTACAATGAAGCTCAGCTCTTTCATTACTATGAGCCAGAAGCCGGTATTTTCATCGCTGAAAGTCCGAAAGTAATCGAGCGGGCAATTAGGGCCGGCTATGAGCCAATCGCCATGCTGGTGGAGGGAAAGGCCTTAGAACGTGATTTAGCGGACTTTGACCGGGAGCTGGCTGCCAACCACGATCACTTGCTTGATTTTCCGATCTTTGTCGCTCAGTCTGACCTTTTGCGCCATCTGCCAGGCTATAATCTGCTTCGGGGCGCCATCTGTGCCTTTCGAAGAAAAAAGCGGCCAAGTCTGCGTGAATTTGCGGCTGCCTTGCCCAAGCATGCCAGAGTCGGGGTCTTAGAGAGCGTCGTCAATCCAACCAATGTTGGCGCTATTTTCCGCTCAGCCGCGGCCTTAGGCATGGACGGGGTCTTGATTACAACCGACTCCAGTGATCCCTTATACCGGAGAAGCGGCCGGGTCAGCATGGGGACGGTTTTCCAGGTGCCTTGGACTTATCTGGATCAAAAACTTTGGCGGGAAAAAGGCGTGGCCAGCCTGCAGGAATTGGGCTTTAAGACCGCGGCCATGGCTTTAAGGGACAACACGGTTGACATCGACGACCCGGTCTTAAAAGAAGCAGACCGTCTGGCTGTCATTTTAGGTTCTGAAGGACCAGGCCTGTTGCCGCAAACGATCGCGGAGAGCGACTATACGATCAAGATACCGATGGCTGAAGGAGTGGACTCCTTGAGTGTTGCCGCCGCTAGCGCTTTAGCCTTTTGGGAAGTCAAAAAAGGACTGGATTAA