COMMON DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST https://dfast.ddbj.nig.ac.jp/ ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2821361 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 517..1878 product DNA polymerase III subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290433.1 CDS 2156..3289 product DNA polymerase III subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969811.1 CDS 3679..3915 product RNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene yaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789359.1 CDS 3912..5024 product DNA replication and repair protein RecF transl_table 11 codon_start 1 locus_tag LOCUS_00040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775113.1 CDS 5037..6968 product DNA gyrase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene gyrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255578.1 CDS 7005..9668 product DNA gyrase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene gyrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819096.1 CDS complement(9755..10567) product NAD(P)H-hydrate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene nnrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449218.1 CDS 10893..12407 product histidine ammonia-lyase transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene hutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177465.1 CDS 12786..14072 product serine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene serS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884332.1 CDS 14722..15417 product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_00100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190726.1 CDS 15414..15743 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_00110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628051.1 CDS 16106..17074 product homoserine O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186490.1 CDS 17380..18303 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_00130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800884.1 CDS 18318..20285 product DHH family phosphoesterase transl_table 11 codon_start 1 locus_tag LOCUS_00140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081640.1 CDS 20282..20734 product 50S ribosomal protein L9 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene rplI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864305.1 CDS 20766..22166 product Replicative DNA helicase transl_table 11 codon_start 1 locus_tag LOCUS_00160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375647.1 CDS 22444..23727 product adenylosuccinate synthetase transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene purA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095328.1 tRNA 24157..24231 product tRNA-Glu locus_tag LOCUS_t00010 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 24239..24311 product tRNA-Met locus_tag LOCUS_t00020 inference COORDINATES:profile:Aragorn:1.2.38 CDS 24931..25632 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_00180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101976.1 CDS 25645..27471 product Sensor protein kinase WalK transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene walK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871607.1 CDS 27464..28798 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060140.1 CDS 28799..29587 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104165.1 CDS 29986..30777 product MBL fold metallo-hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_00220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088649.1 CDS 31005..33323 product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_00230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645787.1 CDS 33691..34170 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 CDS 34712..36457 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700190.1 CDS complement(36551..37003) product dihydrouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_00260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(37218..37973) product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_00270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355845.1 CDS complement(37973..38233) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105088.1 CDS 38370..39437 product dihydroneopterin aldolase transl_table 11 codon_start 1 locus_tag LOCUS_00290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816133.1 CDS 39468..40802 product Rhodanese domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_00300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465472.1 CDS 40821..42014 product NAD(P)/FAD-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_00310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033018.1 CDS complement(42681..43667) product tRNA-dihydrouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_00320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822528.1 CDS 44228..44524 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201644.1 CDS complement(44596..45816) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_00340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101031.1 CDS complement(45809..46360) product Flavodoxin_2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_00350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 46473..47333 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 CDS complement(47689..48222) product DUF4865 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_00370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836457.1 CDS 48322..49056 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351709.1 CDS 49481..50092 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908956.1 CDS 50359..53511 product ATPase transl_table 11 codon_start 1 locus_tag LOCUS_00400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080564.1 CDS 53568..54050 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410567.1 CDS 54255..55241 product 1-phosphatidylinositol phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene plc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710555.1 CDS 55465..56232 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_00430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977777.1 CDS 56284..57054 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_00440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977803.1 CDS 57118..57888 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_00450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977803.1 CDS 57955..58722 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_00460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826312.1 CDS 58816..61053 product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840500.1 CDS 61204..62382 product amidohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_00480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075809.1 CDS 62384..63772 product MFS domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_00490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006441.1 CDS complement(64265..65932) product PhoU domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_00500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800966.1 CDS complement(66252..68027) product oleate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_00510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291840.1 CDS complement(68201..69073) product EamA family transporter transl_table 11 codon_start 1 locus_tag LOCUS_00520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038103.1 CDS 69186..70583 product PLP-dependent aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_00530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205592.1 CDS 70773..71246 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036330.1 CDS 71508..73100 product L-lactate permease transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene lctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173891.1 CDS complement(73429..74979) product Immunoglobulin G-binding protein A transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene spa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728765.1 CDS complement(75400..76152) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876756.1 CDS complement(76521..77519) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene sirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136633.1 CDS complement(77516..78511) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene sirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924990.1 CDS complement(78527..79519) product iron ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene sirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045111.1 CDS 79750..80730 product siderophore biosynthesis protein SbnA transl_table 11 codon_start 1 locus_tag LOCUS_00610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570808.1 CDS 80727..81737 product 2,3-diaminopropionate biosynthesis protein SbnB transl_table 11 codon_start 1 locus_tag LOCUS_00620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078461.1 CDS 81758..83512 product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene sbnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179385.1 CDS 83505..84761 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_00640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610051.1 CDS 84751..86487 product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_00650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179886.1 CDS 86468..88246 product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_00660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795344.1 CDS 88221..88997 product siderophore biosynthesis protein SbnG transl_table 11 codon_start 1 locus_tag LOCUS_00670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186804.1 CDS 88997..90199 product diaminopimelate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_00680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223713.1 CDS 90203..90967 product siderophore biosynthesis protein SbnI transl_table 11 codon_start 1 locus_tag LOCUS_00690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015549.1 CDS 91163..91570 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 91620..92246 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_00710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414629.1 CDS 92458..93234 product diacetyl reductase ((S)-acetoin forming) transl_table 11 codon_start 1 locus_tag LOCUS_00720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183771.1 CDS complement(93283..93435) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 93579..94550 product NAD-dependent dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_00740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793242.1 CDS 94513..95205 product UDP-phosphate N-acetylgalactosaminyl-1-phosphate transferase transl_table 11 codon_start 1 locus_tag LOCUS_00750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736082.1 CDS 95415..96581 product glycosyltransferase family 1 protein transl_table 11 codon_start 1 locus_tag LOCUS_00760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692504.1 CDS 96562..97800 product ligase transl_table 11 codon_start 1 locus_tag LOCUS_00770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431230.1 CDS 97790..99220 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834089.1 CDS 99488..100087 product Superoxide dismutase [Mn/Fe] 2 transl_table 11 codon_start 1 locus_tag LOCUS_00790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874681.1 CDS 100455..101054 product Uncharacterized protein SAOUHSC_00094 transl_table 11 codon_start 1 locus_tag LOCUS_00800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731949.1 note frameshifted, insertion/deletion at around 100940 CDS 100945..101178 product Cell-wall-anchored protein SasD (LPXAG motif) transl_table 11 codon_start 1 locus_tag LOCUS_00810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 100940 CDS complement(101370..102110) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795345.1 CDS 102361..103068 product purine-nucleoside phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene deoD_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 CDS 103075..104427 product tetracycline efflux MFS transporter Tet(38) transl_table 11 codon_start 1 locus_tag LOCUS_00840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 CDS 104508..105170 product 2-deoxyribose-5-phosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene deoC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667269.1 CDS 105198..106376 product phosphopentomutase transl_table 11 codon_start 1 locus_tag LOCUS_00860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197806.1 CDS complement(106507..107322) product phosphonate ABC transporter, permease protein PhnE transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene phnE_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191092.1 CDS complement(107319..108119) product phosphonate ABC transporter, permease protein PhnE transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene phnE_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127689.1 CDS complement(108121..108894) product phosphonates import ATP-binding protein PhnC transl_table 11 codon_start 1 locus_tag LOCUS_00890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 CDS complement(109108..110064) product phosphonate ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_00900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787777.1 CDS 110293..111837 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725608.1 CDS 111888..113423 product bifunctional metallophosphatase/5'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_00920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065030.1 CDS 113516..113710 product Transcription regulator transl_table 11 codon_start 1 locus_tag LOCUS_00930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 114083..114568 product replication initiation protein transl_table 11 codon_start 1 locus_tag LOCUS_00940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 114496 CDS 114553..114843 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 114496 CDS 115026..115214 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 115867..116088 product IS200/IS605 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_00970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 115858 note possible pseudo due to internal stop codon CDS 116538..119147 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene adhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955781.1 CDS 119492..120160 product capsular polysaccharide type 5 biosynthesis protein cap5A transl_table 11 codon_start 1 locus_tag LOCUS_00990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446299.1 CDS 120176..120862 product capsular polysaccharide biosynthesis protein Cap5B transl_table 11 codon_start 1 locus_tag LOCUS_01000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037332.1 CDS 120865..121629 product capsular polysaccharide biosynthesis protein Cap8C transl_table 11 codon_start 1 locus_tag LOCUS_01010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565304.1 CDS 121649..123472 product polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_01020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940790.1 CDS 123462..124490 product Galactowaldenase transl_table 11 codon_start 1 locus_tag LOCUS_01030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459062.1 CDS 124503..125612 product capsular polysaccharide biosynthesis protein Cap8F transl_table 11 codon_start 1 locus_tag LOCUS_01040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028283.1 CDS 125616..126740 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) transl_table 11 codon_start 1 locus_tag LOCUS_01050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 CDS 126743..127369 product O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216898.1 CDS 127374..128483 product capsular polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_01070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 CDS 128497..129663 product capsular polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_01080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668175.1 CDS 129656..130861 product capsular polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_01090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239647.1 CDS 130862..132067 product glycosyltransferase WbuB transl_table 11 codon_start 1 locus_tag LOCUS_01100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291020.1 CDS 132078..132635 product sugar transferase transl_table 11 codon_start 1 locus_tag LOCUS_01110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 CDS 132635..133522 product UDP-glucose 4-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_01120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230679.1 CDS 133576..134838 product UDP-N-acetyl-D-mannosamine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 CDS 134915..136060 product UDP-N-acetylglucosamine 2-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_01140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723436.1 CDS complement(136125..136451) product monooxygenase IsdI transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene isdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480603.1 CDS complement(136458..136841) product DUF454 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_01160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237004.1 CDS 137268..138755 product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290397.1 CDS 139401..140360 product cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_01180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 CDS complement(140422..140625) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356963.1 CDS 140804..141316 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 CDS 141658..142398 product sulfonate ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590854.1 CDS 142412..143386 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826669.1 CDS 143383..144144 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197961.1 CDS 144157..145188 product acyl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171645.1 CDS 145405..145764 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092004.1 CDS 145937..146962 product formate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706135.1 CDS 147348..148598 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_01270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826862.1 CDS 149045..156220 product non-ribosomal peptide synthetase transl_table 11 codon_start 1 locus_tag LOCUS_01280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605281.1 CDS 156233..156877 product 4'-phosphopantetheinyl transferase transl_table 11 codon_start 1 locus_tag LOCUS_01290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215722.1 CDS complement(157205..157699) product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_01300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822554.1 CDS complement(157954..158718) product acetylglutamate kinase transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene argB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668894.1 CDS complement(158734..159975) product bifunctional glutamate N-acetyltransferase/amino-acid N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene argJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682619.1 CDS complement(159987..161018) product N-acetyl-gamma-glutamyl-phosphate reductase transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene argC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598482.1 CDS complement(161057..162241) product Ornithine aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene rocD_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084442.1 CDS complement(162494..163849) product branched-chain amino acid transporter II carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene brnQ_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728170.1 CDS complement(164125..164622) product Isochorismatase domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_01360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557561.1 CDS complement(164749..166389) product indolepyruvate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ipdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813525.1 CDS complement(166663..168708) product PTS glucose EIICBA component transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene ptsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227709.1 CDS 169294..170349 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835000.1 CDS 170346..171245 product N-acetylmuramic acid 6-phosphate etherase transl_table 11 codon_start 1 locus_tag LOCUS_01400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432017.1 CDS 171257..172711 product permease transl_table 11 codon_start 1 locus_tag LOCUS_01410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159750.1 CDS 172711..173589 product RpiR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_01420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181832.1 CDS 174277..177066 product type-1 restriction enzyme R protein transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene hsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331330.1 CDS 177271..178113 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 CDS 178115..179038 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321154.1 CDS 179025..180137 product RES domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_01460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(180402..181994) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067352.1 CDS 182470..183429 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 183435..184598 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240113.1 CDS 184615..186390 product peptide ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720816.1 CDS 186428..188434 product Glutathione hydrolase proenzyme transl_table 11 codon_start 1 locus_tag LOCUS_01510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236427.1 CDS complement(188732..189505) product Putative lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_01520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643619.1 CDS complement(189695..190321) product FMN-dependent NADH-azoreductase transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene azoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151451.1 CDS 190530..191108 product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_01540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166920.1 CDS 191491..192588 product sugar ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818915.1 CDS 192601..193872 product maltose ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034961.1 CDS 193875..195143 product maltose ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166892.1 CDS 195145..195984 product maltose ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 CDS 196058..197134 product gfo/Idh/MocA family oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_01590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 CDS 197159..198199 product gfo/Idh/MocA family oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_01600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163820.1 CDS 198254..199222 product xylose isomerase transl_table 11 codon_start 1 locus_tag LOCUS_01610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 CDS complement(199583..200077) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_01620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794523.1 CDS 200310..201689 product hexose phosphate transporter transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene uhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008722.1 CDS complement(202048..202806) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_01640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477526.1 CDS complement(202799..204355) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_01650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127990.1 CDS complement(204352..205320) product lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_01660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837116.1 CDS 205908..208157 product formate acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894660.1 CDS 208180..208935 product pyruvate formate-lyase-activating enzyme transl_table 11 codon_start 1 locus_tag LOCUS_01680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911657.1 CDS 209271..211034 product glycerophosphoryl diester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_01690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822589.1 CDS complement(211198..211542) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211597.1 CDS 211732..213642 product coagulase transl_table 11 codon_start 1 locus_tag LOCUS_01710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744096.1 CDS complement(214246..215430) product Acetoacetyl-CoA thiolase transl_table 11 codon_start 1 locus_tag LOCUS_01720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154619.1 CDS complement(215460..217721) product 3-hydroxyacyl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154537.1 CDS complement(217907..219118) product glutaryl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene fadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142199.1 CDS complement(219230..220735) product long-chain-fatty-acid--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene fadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008400.1 CDS complement(220761..222323) product acyl CoA:acetate/3-ketoacid CoA transferase transl_table 11 codon_start 1 locus_tag LOCUS_01760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795358.1 CDS 222692..223921 product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_01770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922818.1 CDS complement(224235..225647) product nickel ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556251.1 CDS complement(225908..226264) product DUF488 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_01790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215216.1 CDS complement(226421..226594) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773989.1 CDS complement(226620..227765) product nitric oxide dioxygenase transl_table 11 codon_start 1 locus_tag LOCUS_01810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954799.1 CDS 228338..229291 product L-lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene ldh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031880.1 CDS complement(229611..231140) product PTS glucose transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_01830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 CDS 231502..232437 product nucleoside hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_01840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823221.1 CDS 232776..234872 product transcriptional antiterminator transl_table 11 codon_start 1 locus_tag LOCUS_01850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012737.1 CDS 234857..235324 product PTS sugar transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_01860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531476.1 CDS 235347..235625 product PTS galactitol transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_01870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815795.1 CDS 235852..237111 product PTS galactitol transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_01880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120109.1 CDS 237129..238184 product Alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646211.1 CDS 238186..238332 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230358.1 CDS 238356..239399 product galactitol-1-phosphate 5-dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645608.1 CDS 239927..240643 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene tarI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638475.1 CDS 240636..241661 product alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene tarJ_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610180.1 CDS 241683..243377 product tagB protein transl_table 11 codon_start 1 locus_tag LOCUS_01940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031898830.1 CDS 243805..244974 product Putative teichoic acid biosynthesis protein F transl_table 11 codon_start 1 locus_tag LOCUS_01950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594817.1 CDS 245250..245966 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872486.1 CDS 245959..246984 product ribitol-5-phosphate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene tarJ_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 CDS 247006..248694 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240920.1 CDS 248730..250451 product Glycosyl transferase, group 2 family protein transl_table 11 codon_start 1 locus_tag LOCUS_01990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 CDS 250591..251265 product iron-sulfur cluster repair protein ScdA transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene scdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608818.1 CDS 251512..253266 product Autolysin sensor kinase transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene lytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925394.1 CDS 253269..254009 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene lytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645452.1 CDS 254128..254565 product antiholin-like protein LrgA transl_table 11 codon_start 1 locus_tag LOCUS_02030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792906.1 CDS 254558..255259 product antiholin-like protein LrgB transl_table 11 codon_start 1 locus_tag LOCUS_02040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607067.1 CDS complement(255367..256071) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_02050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922320.1 CDS 256220..257011 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066931.1 CDS 257027..258463 product 6-phospho-beta-glucosidase transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene bglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164003.1 CDS complement(258896..259657) product SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031262.1 CDS complement(259908..260822) product ribokinase transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene rbsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182746.1 CDS complement(260850..261254) product D-ribose pyranase transl_table 11 codon_start 1 locus_tag LOCUS_02100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747873.1 CDS complement(261269..262150) product Putative glucose uptake protein GlcU transl_table 11 codon_start 1 locus_tag LOCUS_02110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029196.1 CDS complement(262382..263380) product LacI family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_02120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757880.1 CDS 263531..263710 product NADH dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_02130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792075.1 CDS 263760..264152 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159765.1 CDS 264380..264784 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_02150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(264825..266201) product Drug transporter, putative transl_table 11 codon_start 1 locus_tag LOCUS_02160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066548.1 CDS 266435..267427 product CBAH domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337368.1 CDS 267753..268703 product glycyl-glycine endopeptidase LytM transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene lytM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736784.1 CDS complement(268755..269414) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570070.1 CDS complement(269428..270348) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_02200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806102.1 CDS complement(270345..271511) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_02210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848761.1 CDS complement(271579..273102) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038527.1 CDS 273373..274026 product DUF5079 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 274060..274647 product DUF5080 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(274790..275683) product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751215.1 CDS 275931..276224 product virulence factor EsxA transl_table 11 codon_start 1 locus_tag LOCUS_02260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240826.1 CDS 276308..279337 product Type VII secretion system accessory factor EsaA transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene esaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728958.1 CDS 279337..279795 product protein EssA transl_table 11 codon_start 1 locus_tag LOCUS_02280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928938.1 CDS 279767..280009 product Type VII secretion system accessory factor EsaB transl_table 11 codon_start 1 locus_tag LOCUS_02290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011446982.1 CDS 280022..281356 product protein EssB transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene essB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240338.1 CDS 281378..285817 product protein EssC transl_table 11 codon_start 1 locus_tag LOCUS_02310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549287.1 CDS 285847..286239 product protein EsaC transl_table 11 codon_start 1 locus_tag LOCUS_02320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010292.1 CDS 286255..286569 product virulence factor EsxB transl_table 11 codon_start 1 locus_tag LOCUS_02330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509671.1 CDS 286566..287243 product DUF5081 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655881.1 CDS 287249..287560 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene esxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175722.1 CDS 287570..289414 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159018.1 CDS 289425..289916 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142044.1 CDS 290124..290807 product DUF5079 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208417.1 CDS 290954..291565 product DUF5080 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394911.1 CDS 291701..291919 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431307.1 CDS 292051..292551 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008493.1 CDS 292562..293062 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141941.1 CDS 293073..293573 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141941.1 CDS 293584..294084 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008493.1 CDS 294095..294583 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575678.1 CDS 295206..295580 product cystatin-like fold lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_02460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822161.1 CDS 295733..296131 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_02470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415665.1 CDS complement(296347..297171) product formate/nitrite transporter transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene fnt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 CDS complement(297408..298715) product branched-chain amino acid transporter II carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_02490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745087.1 CDS 298636..298875 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene brnQ_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509378.1 CDS 299299..300189 product 5'-nucleotidase, lipoprotein e(P4) family transl_table 11 codon_start 1 locus_tag LOCUS_02510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033876.1 CDS 300438..301487 product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_02520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477931.1 CDS 301500..302177 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911017.1 CDS 302385..303416 product PTS sugar transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene pfoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031825880.1 CDS 303759..304877 product carbohydrate kinase transl_table 11 codon_start 1 locus_tag LOCUS_02550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283968.1 CDS 304852..305775 product pseudouridine-5'-phosphate glycosidase transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene psuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 CDS 305786..307006 product pyrimidine nucleoside transporter NupC transl_table 11 codon_start 1 locus_tag LOCUS_02570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022972.1 CDS complement(307111..308643) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 CDS complement(308683..309564) product N-acetylneuraminate lyase transl_table 11 codon_start 1 locus_tag LOCUS_02590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030736.1 CDS 309722..310582 product ROK family protein transl_table 11 codon_start 1 locus_tag LOCUS_02600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291444.1 CDS complement(310860..311660) product Putative transcription regulator transl_table 11 codon_start 1 locus_tag LOCUS_02610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667382.1 CDS 311800..312468 product N-acetylmannosamine-6-phosphate 2-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_02620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936718.1 CDS complement(312595..313908) product histidine transporter transl_table 11 codon_start 1 locus_tag LOCUS_02630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077725.1 CDS 314326..316398 product Triacylglycerol lipase transl_table 11 codon_start 1 locus_tag LOCUS_02640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943819.1 CDS complement(316640..317467) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_02650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 CDS complement(317540..318739) product NADH-dependent flavin oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_02660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286459.1 CDS 319041..320042 product Bac_luciferase domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240063.1 CDS 320076..320408 product glycine cleavage system protein H transl_table 11 codon_start 1 locus_tag LOCUS_02680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731878.1 CDS 320409..321209 product Protein-ADP-ribose hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_02690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 CDS 321196..322143 product Deacetylase sirtuin-type domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191954.1 CDS 322121..323143 product lipoate--protein ligase A transl_table 11 codon_start 1 locus_tag LOCUS_02710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280799.1 CDS 323458..324483 product 3Beta_HSD domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 CDS complement(324576..325922) product PTS ascorbate transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_02730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147974.1 CDS complement(325937..326221) product PTS lactose transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_02740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699538.1 CDS complement(326223..326666) product PTS ascorbate transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_02750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050760.1 CDS complement(326671..328626) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954271.1 CDS 328838..329257 product multidrug efflux MATE transporter transcriptional repressor MepR transl_table 11 codon_start 1 locus_tag LOCUS_02770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397416.1 CDS 329364..330719 product multidrug efflux MATE transporter MepA transl_table 11 codon_start 1 locus_tag LOCUS_02780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651051.1 CDS 330823..331263 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278313.1 CDS complement(331346..332704) product glycerol-3-phosphate transporter transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene glpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010111.1 CDS complement(332868..333029) product Glyoxalase family protein transl_table 11 codon_start 1 locus_tag LOCUS_02810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 333012..333938 product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_02820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028200.1 CDS 333952..335013 product LLM class flavin-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_02830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096113.1 CDS 335027..335593 product NAD(P)H-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_02840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028429.1 CDS complement(335653..336648) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_02850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157630.1 CDS 336647..337054 product Nitrogen regulation protein NIFR3 transl_table 11 codon_start 1 locus_tag LOCUS_02860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093031.1 CDS 337067..337612 product RimJ/RimL family protein N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 CDS 337880..338734 product EfeM/EfeO family lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_02880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737196.1 CDS 338731..339960 product deferrochelatase/peroxidase EfeB transl_table 11 codon_start 1 locus_tag LOCUS_02890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186223.1 CDS 339941..341653 product Conserved domain protein transl_table 11 codon_start 1 locus_tag LOCUS_02900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822764.1 CDS complement(341746..342351) product Sec-independent protein translocase protein TatC transl_table 11 codon_start 1 locus_tag LOCUS_02910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922821.1 CDS complement(342464..342679) product Sec-independent protein translocase protein TatA transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene tatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794540.1 CDS complement(342788..343177) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886004.1 CDS 343418..343621 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_02940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246008.1 CDS 343618..344331 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698749.1 CDS 344356..345198 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209551.1 CDS 345198..345827 product ABC-2 transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_02970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677725.1 CDS complement(346194..347327) product Low temperature requirement protein LtrA transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene ltrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245682.1 CDS 347866..349047 product acetyl-CoA acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199066.1 CDS complement(349130..349882) product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_03000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 CDS complement(349925..352153) product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene metE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207623.1 CDS complement(352150..353991) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase transl_table 11 codon_start 1 locus_tag LOCUS_03020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077317.1 CDS complement(353960..355120) product cystathionine beta-lyase transl_table 11 codon_start 1 locus_tag LOCUS_03030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175854.1 CDS complement(355117..356220) product cystathionine gamma-synthase transl_table 11 codon_start 1 locus_tag LOCUS_03040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655692.1 CDS 356893..357729 product chromosome partitioning protein ParB transl_table 11 codon_start 1 locus_tag LOCUS_03050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557587.1 CDS 357886..358767 product mechanosensitive ion channel protein MscS transl_table 11 codon_start 1 locus_tag LOCUS_03060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373073.1 CDS 358797..359000 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157348.1 CDS 359012..360109 product GTP-binding protein YchF transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene ychF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218732.1 CDS complement(360195..360386) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052484.1 CDS 360630..360926 product 30S ribosomal protein S6 transl_table 11 codon_start 1 locus_tag LOCUS_03100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261460.1 CDS 360947..361450 product single-stranded DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene ssb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934799.1 CDS 361502..361744 product 30S ribosomal protein S18 transl_table 11 codon_start 1 locus_tag LOCUS_03120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897044.1 CDS complement(362010..362984) product Abi-like protein transl_table 11 codon_start 1 locus_tag LOCUS_03130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817700.1 CDS complement(362987..363298) product integrase transl_table 11 codon_start 1 locus_tag LOCUS_03140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(363376..363534) product integrase transl_table 11 codon_start 1 locus_tag LOCUS_03150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 363894..364505 product toxin transl_table 11 codon_start 1 locus_tag LOCUS_03160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475325.1 CDS 364874..365242 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene yxeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849163.1 CDS 365423..365995 product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_03180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769722.1 CDS complement(366133..366396) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_03190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055897.1 CDS 366696..366947 product GlsB/YeaQ/YmgE family stress response membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_03200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466748.1 CDS complement(366986..367195) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211677.1 CDS 367373..367954 product histidine phosphatase family protein transl_table 11 codon_start 1 locus_tag LOCUS_03220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158375.1 CDS complement(368020..368403) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868259.1 CDS complement(368658..369284) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746679.1 CDS complement(369357..369614) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(369729..371252) product alkyl hydroperoxide reductase subunit F transl_table 11 codon_start 1 locus_tag LOCUS_03260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930514.1 CDS complement(371268..371837) product alkyl hydroperoxide reductase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_03270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052781.1 CDS 372329..373084 product NADPH-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene nfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287099.1 CDS complement(373165..374553) product L-cystine transporter transl_table 11 codon_start 1 locus_tag LOCUS_03290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991018.1 CDS complement(375530..376486) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956137.1 CDS complement(376604..377266) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394698.1 CDS complement(377409..377816) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763767.1 CDS 378329..378907 product xanthine phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene xpt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421410.1 CDS 378907..380175 product xanthine permease transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene pbuX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793018.1 CDS 380213..381679 product IMP dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_03350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264071.1 CDS 381704..383245 product GMP synthase (glutamine-hydrolyzing) transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene guaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424963.1 CDS complement(383358..383894) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551643.1 CDS complement(384287..384991) product MazF/PemK family toxin transl_table 11 codon_start 1 locus_tag LOCUS_03380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041880.1 CDS complement(385390..385662) product transposase transl_table 11 codon_start 1 locus_tag LOCUS_03390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159787.1 CDS complement(385923..386075) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248844.1 CDS complement(386599..386958) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_03410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021623.1 CDS complement(386977..387822) product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_03420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024371.1 CDS 388294..388974 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669014.1 CDS 389260..389955 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782622.1 CDS 390246..391316 product Superantigen-like protein transl_table 11 codon_start 1 locus_tag LOCUS_03450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056483.1 CDS 391681..392607 product Superantigen-like protein transl_table 11 codon_start 1 locus_tag LOCUS_03460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705657.1 CDS 392971..393675 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781349.1 CDS 394121..394816 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 395237..395932 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769820.1 CDS 396276..396974 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673034.1 CDS 397354..398052 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778500.1 CDS 398418..399101 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673051.1 CDS 399365..400921 product type I restriction-modification system subunit M transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene hsdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028663.1 CDS 400914..402125 product restriction endonuclease subunit S transl_table 11 codon_start 1 locus_tag LOCUS_03540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 CDS 402508..403185 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769160.1 CDS 403207..404715 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208917.1 CDS complement(404819..405127) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene spn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669519.1 CDS 405465..406283 product Uncharacterized lipoprotein SAOUHSC_00402 transl_table 11 codon_start 1 locus_tag LOCUS_03580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540323.1 CDS 406302..407087 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_03590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835971.1 CDS 407270..408082 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_03600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540879.1 CDS 408072..409400 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653707.1 CDS 409397..409720 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971497.1 CDS 409739..410053 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172535.1 CDS complement(410343..410537) product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_03640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797248.1 CDS 410722..411924 product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 CDS 413512..414996 product NADH dehydrogenase subunit 5 transl_table 11 codon_start 1 locus_tag LOCUS_03660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948295.1 CDS 415009..417714 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene dabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211545.1 CDS 417876..418238 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 CDS 418921..419595 product phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_03690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565813.1 CDS 419632..420366 product carboxylesterase transl_table 11 codon_start 1 locus_tag LOCUS_03700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220811.1 CDS 420822..422159 product Transporter transl_table 11 codon_start 1 locus_tag LOCUS_03710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828719.1 CDS 422346..423290 product O-acetylserine dependent cystathionine beta-synthase transl_table 11 codon_start 1 locus_tag LOCUS_03720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634098.1 CDS 423274..424416 product cystathionine gamma-synthase transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene metB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036648.1 CDS 424710..425735 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569281.1 CDS 425739..426398 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_03750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 CDS 426435..427277 product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825530.1 CDS 427609..428613 product N-acetylmuramoyl-L-alanine amidase transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene sle inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170264.1 CDS complement(428798..429067) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129473.1 CDS 429216..429611 product DNA mismatch repair protein MutT transl_table 11 codon_start 1 locus_tag LOCUS_03790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588522.1 CDS 429601..430086 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_03800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183668.1 CDS complement(430255..431037) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994678.1 CDS complement(431034..432146) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794550.1 CDS complement(432267..433151) product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene gltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403915.1 CDS 433332..437831 product Glutamate synthase, large subunit transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene gltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551342.1 CDS 437849..439312 product glutamate synthase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_03850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503590.1 tRNA 439581..439673 product tRNA-Ser locus_tag LOCUS_t00030 inference COORDINATES:profile:Aragorn:1.2.38 CDS 440144..441571 product PTS ascorbate transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene treP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279361.1 CDS 441635..443275 product glucohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_03870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031490.1 CDS 443300..444028 product trehalose operon repressor transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene treR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118675.1 CDS 444667..445191 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_03890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167828.1 CDS 445260..446957 product DNA polymerase III subunit gamma/tau transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene dnaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109040.1 CDS 447047..447364 product YbaB/EbfC family nucleoid-associated protein transl_table 11 codon_start 1 locus_tag LOCUS_03910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213992.1 CDS 447371..447967 product 5S ribosomal RNA transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene recR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559159.1 CDS 448349..448510 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator rRNA 448822..450371 product 16S ribosomal RNA locus_tag LOCUS_r00010 inference COORDINATES:profile:Barrnap:0.8 rRNA 450741..453659 product 23S ribosomal RNA locus_tag LOCUS_r00020 inference COORDINATES:profile:Barrnap:0.8 rRNA 453736..453809 product 23S ribosomal RNA locus_tag LOCUS_r00030 inference COORDINATES:profile:Barrnap:0.8 note aligned only 62 percent of the 5S ribosomal RNA CDS 454730..456067 product lysine decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_03940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812829.1 CDS 456069..456686 product thymidylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_03950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272126.1 CDS 456714..457043 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 CDS 457257..458183 product DNA polymerase III subunit delta' transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene holB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344336.1 CDS 458184..458987 product signal peptidase II transl_table 11 codon_start 1 locus_tag LOCUS_03980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134194.1 CDS 459004..459351 product initiation-control protein YabA transl_table 11 codon_start 1 locus_tag LOCUS_03990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375683.1 CDS 459625..460350 product tRNA1(Val) (adenine(37)-N6)-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910686.1 CDS 460343..460591 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 CDS 460593..461432 product rRNA (cytidine-2'-O-)-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rsmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279926.1 CDS 461717..463690 product methionine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene metG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051129.1 CDS 463721..464494 product TatD family deoxyribonuclease transl_table 11 codon_start 1 locus_tag LOCUS_04040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904312.1 CDS 464661..465197 product ribonuclease M5 transl_table 11 codon_start 1 locus_tag LOCUS_04050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700080.1 CDS 465190..466101 product Ribosomal RNA small subunit methyltransferase A transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene ksgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886500.1 CDS 466201..466464 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126664.1 CDS 466774..467622 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene ispE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638870.1 CDS 467636..468460 product pur operon repressor transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene purR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269643.1 CDS 468477..468857 product RidA family protein transl_table 11 codon_start 1 locus_tag LOCUS_04100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 CDS 468929..469231 product stage V sporulation protein G transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene spoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868999.1 CDS 469575..470927 product Bifunctional protein GlmU transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene glmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252543.1 CDS 471074..472039 product ribose-phosphate pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene prs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933774.1 CDS 472189..472842 product 50S ribosomal protein L25/general stress protein Ctc transl_table 11 codon_start 1 locus_tag LOCUS_04140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 CDS 473153..473725 product peptidyl-tRNA hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649791.1 CDS 473725..477231 product Transcription-repair-coupling factor transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene mfd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154218.1 CDS 477221..478747 product stage V sporulation protein B transl_table 11 codon_start 1 locus_tag LOCUS_04170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680740.1 CDS 478747..479940 product nucleotide pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951441.1 CDS 479937..480200 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234988.1 CDS 480218..480610 product cell division protein DIVIC transl_table 11 codon_start 1 locus_tag LOCUS_04200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792417.1 CDS 480715..481116 product RNA-binding protein S1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021445.1 CDS 481296..482591 product tRNA(Ile)-lysidine synthetase transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene tilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176709.1 CDS 482596..483135 product hypoxanthine-guanine phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551283.1 CDS 483392..485485 product Cell division protease FtsH transl_table 11 codon_start 1 locus_tag LOCUS_04240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167888.1 CDS 485714..486595 product redox-regulated molecular chaperone Hsp33 transl_table 11 codon_start 1 locus_tag LOCUS_04250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 CDS 486774..487706 product cysteine synthase transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene cysK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057594.1 CDS 487922..488725 product Dihydropteroate synthase transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene folP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167944.1 CDS 488703..489068 product dihydroneopterin aldolase transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene folB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154302.1 CDS 489065..489541 product 5S ribosomal RNA transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene folK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613722.1 CDS 490080..491567 product lysine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_04300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 rRNA 492127..492204 product lysine--tRNA ligase locus_tag LOCUS_r00040 inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA tRNA 492252..492327 product tRNA-Val locus_tag LOCUS_t00040 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492344..492419 product 5S ribosomal RNA locus_tag LOCUS_t00050 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492425..492499 product tRNA-Lys locus_tag LOCUS_t00060 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492532..492606 product tRNA-Gly locus_tag LOCUS_t00070 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492614..492702 product tRNA-Leu locus_tag LOCUS_t00080 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492708..492784 product tRNA-Arg locus_tag LOCUS_t00090 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492805..492878 product tRNA-Pro locus_tag LOCUS_t00100 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 492902..492977 product tRNA-Val locus_tag LOCUS_t00110 inference COORDINATES:profile:Aragorn:1.2.38 rRNA 493102..494650 product 16S ribosomal RNA locus_tag LOCUS_r00050 inference COORDINATES:profile:Barrnap:0.8 rRNA 495020..497938 product 23S ribosomal RNA locus_tag LOCUS_r00060 inference COORDINATES:profile:Barrnap:0.8 rRNA 498015..498092 product tRNA-Val locus_tag LOCUS_r00070 inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA CDS complement(498652..500034) product PLP-dependent aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_04310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799248.1 CDS 500138..501025 product pyridoxal 5'-phosphate synthase lyase subunit PdxS transl_table 11 codon_start 1 locus_tag LOCUS_04320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034728.1 CDS 501029..501589 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT transl_table 11 codon_start 1 locus_tag LOCUS_04330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690439.1 CDS complement(501797..503011) product pyrimidine nucleoside transporter NupC transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene nupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547794.1 CDS 503169..503630 product transcriptional regulator CtsR transl_table 11 codon_start 1 locus_tag LOCUS_04350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551762.1 CDS 503649..504215 product Excinuclease ABC subunit B transl_table 11 codon_start 1 locus_tag LOCUS_04360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443618.1 CDS 504205..505212 product protein arginine kinase transl_table 11 codon_start 1 locus_tag LOCUS_04370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149502.1 CDS 505226..507682 product ATP-dependent Clp protease ATP-binding subunit ClpC transl_table 11 codon_start 1 locus_tag LOCUS_04380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897132.1 CDS 508167..509531 product DNA repair protein RadA transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene radA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085219.1 CDS 509556..510629 product TRAM domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802965.1 CDS 511186..512640 product Glutamate--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene gltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283792.1 CDS 513069..513710 product serine acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene cysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805237.1 CDS 513694..515094 product cysteine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene cysS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 CDS 515087..515491 product Mini-ribonuclease 3 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene mrnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370182.1 CDS 515499..516245 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB transl_table 11 codon_start 1 locus_tag LOCUS_04450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390332.1 CDS 516245..516769 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664737.1 CDS 516850..517419 product RNA polymerase sigma factor transl_table 11 codon_start 1 locus_tag LOCUS_04470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872882.1 CDS 517733..517915 product Preprotein translocase transl_table 11 codon_start 1 locus_tag LOCUS_04480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074473.1 CDS 517928..518476 product transcription termination/antitermination protein NusG transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene nusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288302.1 CDS 518657..519079 product 50S ribosomal protein L11 transl_table 11 codon_start 1 locus_tag LOCUS_04500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 CDS 519287..519979 product 50S ribosomal protein L1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074619.1 CDS 520251..520751 product 50S ribosomal protein L10 transl_table 11 codon_start 1 locus_tag LOCUS_04520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 CDS 520794..521162 product 50S ribosomal protein L7/L12 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rplL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273586.1 CDS 521337..521945 product methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020304.1 CDS 522160..525711 product DNA-directed RNA polymerase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918667.1 CDS 525848..529471 product DNA-directed RNA polymerase subunit beta' transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788197.1 CDS 529608..529862 product 50S ribosomal protein L7ae-like protein transl_table 11 codon_start 1 locus_tag LOCUS_04570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031892.1 CDS 529960..530373 product 30S ribosomal protein S12 transl_table 11 codon_start 1 locus_tag LOCUS_04580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142337.1 CDS 530439..530909 product 30S ribosomal protein S7 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 CDS 531032..533113 product Translation elongation factor G transl_table 11 codon_start 1 locus_tag LOCUS_04600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090315.1 CDS 533330..534514 product elongation factor Tu transl_table 11 codon_start 1 locus_tag LOCUS_04610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040568.1 CDS complement(534796..535971) product N-acetyl-L,L-diaminopimelate deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_04620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887920.1 CDS 536142..537329 product 2-amino-3-ketobutyrate CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_04630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250823.1 CDS 537595..538473 product Protein/nucleic acid deglycase HchA transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene hchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076404.1 CDS 538632..540269 product ribulokinase transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene araB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122354.1 CDS 540483..541448 product UDP-glucose 4-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_04660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723301.1 CDS 541783..542859 product branched chain amino acid aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene ilvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076036.1 CDS 542832..543005 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 543109..543792 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454780.1 CDS complement(543908..544570) product deoxynucleoside kinase transl_table 11 codon_start 1 locus_tag LOCUS_04700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067261.1 CDS complement(544563..545180) product deoxynucleoside kinase transl_table 11 codon_start 1 locus_tag LOCUS_04710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039516.1 CDS 545247..545717 product tRNA-specific adenosine deaminase transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene tadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180281.1 CDS 545864..546733 product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_04730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593361.1 CDS 546754..547320 product FMN-dependent NADPH-azoreductase transl_table 11 codon_start 1 locus_tag LOCUS_04740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677261.1 CDS 547751..550738 product Serine-aspartate repeat-containing protein C transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene sdrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 551105..555154 product Serine-aspartate repeat-containing protein D transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene sdrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934467.1 CDS 555273..556745 product glycosyl transferase family 1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106740.1 CDS complement(556869..558359) product glycosyl transferase family 1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106104.1 CDS complement(558641..559519) product GTP cyclohydrolase I FolE2 transl_table 11 codon_start 1 locus_tag LOCUS_04790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134236.1 CDS complement(559532..560197) product bacillithiol biosynthesis deacetylase BshB2 transl_table 11 codon_start 1 locus_tag LOCUS_04800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 CDS complement(560211..560570) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557152.1 CDS 560849..561607 product glucosamine-6-phosphate deaminase transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene nagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866415.1 CDS 561684..562316 product 3-hexulose-6-phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_04830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422861.1 CDS 562318..562866 product 6-phospho-3-hexuloisomerase transl_table 11 codon_start 1 locus_tag LOCUS_04840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051594.1 CDS 562979..563626 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 CDS 564128..565528 product proline/betaine transporter transl_table 11 codon_start 1 locus_tag LOCUS_04860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347061.1 CDS 566072..567448 product long-chain-fatty-acid--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_04870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100835.1 CDS 567450..568589 product acetyl-CoA acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene vraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070676.1 CDS 568564..568929 product protein VraC transl_table 11 codon_start 1 locus_tag LOCUS_04890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165058.1 CDS 568932..569201 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671099.1 CDS complement(569402..569569) product protein VraX transl_table 11 codon_start 1 locus_tag LOCUS_04910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587958.1 CDS complement(570076..570906) product Phosphomethylpyrimidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene thiD_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185462.1 CDS 571090..571746 product uracil-DNA glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene ung inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455256.1 CDS 571747..572127 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248117.1 CDS 572260..572628 product DUF423 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 CDS 572749..574233 product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_04960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412514.1 CDS complement(574375..574827) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_04970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498572.1 CDS complement(574840..575604) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354088.1 CDS complement(576153..576905) product heme-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075704.1 CDS 577073..578059 product phosphate acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene pta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774281.1 CDS 578062..578898 product Octanoyl-[GcvH]:protein N-octanoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene lipL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190413.1 CDS 579485..580405 product mevalonate kinase transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene mvk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197034.1 CDS 580410..581393 product diphosphomevalonate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene mvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597327.1 CDS 581406..582482 product phosphomevalonate kinase transl_table 11 codon_start 1 locus_tag LOCUS_05040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616885.1 CDS 582659..583000 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(583052..584374) product FAD-containing oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene merA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860592.1 CDS complement(584361..584801) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047238.1 CDS 585426..586835 product LXG domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020814.1 CDS 586839..587465 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 587600..588232 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882118.1 CDS 588320..588937 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 589012..589641 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 589837..590430 product DUF443 family protein transl_table 11 codon_start 1 locus_tag LOCUS_05130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 590598..591230 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882118.1 CDS 591277..591744 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 591735 CDS 592358..592987 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226989.1 CDS 593111..593752 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226989.1 CDS 593789..594424 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 594390..594635 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 594659..595285 product TIGR01218 family protein transl_table 11 codon_start 1 locus_tag LOCUS_05200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 595555..596493 product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_05210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808888.1 CDS 596704..597240 product flavodoxin family protein transl_table 11 codon_start 1 locus_tag LOCUS_05220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633782.1 CDS 597409..597885 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477505.1 CDS 597925..599220 product HD domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180234.1 CDS 599263..599769 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792725.1 CDS 600268..601278 product zinc-dependent alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_05260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200747.1 CDS 601553..601969 product DUF1934 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene ywiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001819741.1 CDS 601966..603627 product arginine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene argS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021144.1 CDS 604016..604651 product endonuclease III domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901751.1 CDS 605030..605917 product Periplasmic binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817979.1 CDS 606017..607015 product Iron-regulated surface determinant protein F transl_table 11 codon_start 1 locus_tag LOCUS_05310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922824.1 CDS 607070..607789 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_05320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365354.1 CDS 607773..608573 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_05330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362976.1 CDS 608709..609215 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735558.1 CDS 609377..610093 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222133.1 CDS 610262..611050 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_05360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045423.1 CDS complement(611301..611675) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018677.1 CDS complement(612623..613552) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557159.1 CDS complement(613747..613971) product DUF2922 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169042.1 CDS complement(613988..614191) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036086.1 CDS 614350..614910 product Integrase/recombinase, putative transl_table 11 codon_start 1 locus_tag LOCUS_05410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044915.1 CDS 614929..617331 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_05420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060771.1 CDS 617318..617743 product Na(+)/H(+) antiporter subunit B transl_table 11 codon_start 1 locus_tag LOCUS_05430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661906.1 CDS 617740..618084 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_05440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048985.1 CDS 618074..619570 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_05450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950546.1 CDS 619571..620053 product Na+/H+ antiporter subunit E transl_table 11 codon_start 1 locus_tag LOCUS_05460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071971.1 CDS 620050..620352 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_05470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616642.1 CDS 620327..620764 product Antiporter subunit mnhG2 transl_table 11 codon_start 1 locus_tag LOCUS_05480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072353857.1 CDS 621104..623146 product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_05490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402171.1 CDS complement(624572..625510) product ABC transporter, substrate-binding protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_05500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737654.1 CDS complement(625507..626343) product metal ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889252.1 CDS complement(626337..627080) product phosphonate ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894464.1 CDS 627202..627846 product DtxR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954654.1 CDS complement(627926..628678) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108547.1 CDS 628914..629678 product N-acetylmannosaminyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene tagA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215388.1 CDS complement(629739..630533) product teichoic acids export ATP-binding protein TagH transl_table 11 codon_start 1 locus_tag LOCUS_05560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103231.1 CDS 630880..631692 product teichoic acid ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene tagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273058.1 CDS 631791..632894 product teichoic acid biosynthesis protein B transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene tagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101602.1 CDS 632891..633952 product glycosyl transferase transl_table 11 codon_start 1 locus_tag LOCUS_05590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241182.1 CDS 634015..634413 product glycerol-3-phosphate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832260.1 CDS complement(634530..635825) product D-alanyl-D-alanine carboxypeptidase transl_table 11 codon_start 1 locus_tag LOCUS_05610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793067.1 CDS 636246..637973 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817954.1 CDS 638332..639561 product nucleoside permease transl_table 11 codon_start 1 locus_tag LOCUS_05630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479279.1 CDS 640086..640919 product YitT family protein transl_table 11 codon_start 1 locus_tag LOCUS_05640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044662.1 CDS 641201..641998 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene fhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080809.1 CDS 642034..643038 product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene fhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184741.1 CDS 643035..644051 product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625878.1 CDS 644285..645253 product dihydroxyacetone kinase subunit DhaK transl_table 11 codon_start 1 locus_tag LOCUS_05680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976269.1 CDS 645295..645879 product dihydroxyacetone kinase subunit L transl_table 11 codon_start 1 locus_tag LOCUS_05690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867201.1 CDS 645872..646234 product PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM transl_table 11 codon_start 1 locus_tag LOCUS_05700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124167.1 CDS 646350..646847 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164085.1 CDS 647303..648370 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980137.1 CDS 648521..649564 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_05730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030772.1 CDS 649893..650321 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene yvdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198504.1 CDS complement(650530..651036) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940129.1 CDS 651149..652072 product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_05760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802955.1 CDS 652088..652762 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene graR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166500.1 CDS 652755..653795 product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_05780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061264.1 CDS 653939..654700 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985996.1 CDS 654690..656579 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143615.1 CDS 657304..657921 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491755.1 CDS 657937..658944 product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_05820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120368.1 CDS complement(659532..660329) product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_05830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731644.1 CDS 660690..661334 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081602.1 CDS 662031..664181 product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129749.1 CDS 664327..664686 product HTH-type transcriptional regulator SarX transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene sarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074490.1 CDS 664876..665592 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532966.1 CDS 665592..666065 product cupin transl_table 11 codon_start 1 locus_tag LOCUS_05880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833486.1 CDS 666418..667062 product DUF402 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865624.1 CDS 667178..668044 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687412.1 CDS 668251..669465 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_05910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367062.1 CDS 669462..669950 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152582.1 CDS complement(670049..670738) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842860.1 CDS 670865..671308 product Acetyltransferase, GNAT family transl_table 11 codon_start 1 locus_tag LOCUS_05940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259672.1 CDS 671375..671770 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733432.1 CDS 671908..672207 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545115.1 CDS 672287..672829 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638613.1 CDS complement(672925..673491) product Rossman fold protein, TIGR00730 family transl_table 11 codon_start 1 locus_tag LOCUS_05980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820897.1 CDS complement(673493..673951) product DUF188 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148826.1 CDS complement(673954..674637) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358498.1 CDS complement(674809..675684) product undecaprenyl-diphosphatase transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene uppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469894.1 CDS 675903..677534 product cysteine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737160.1 CDS 677531..679204 product cysteine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857598.1 CDS complement(679331..679774) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_06040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283444.1 CDS 680001..680927 product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794419.1 CDS 681030..681938 product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_06060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435109.1 CDS 681973..682260 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180416.1 CDS 682543..684096 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_06080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288051.1 CDS 684182..685555 product Deoxyribodipyrimidine photolyase, putative transl_table 11 codon_start 1 locus_tag LOCUS_06090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952038.1 CDS complement(685710..685994) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(685991..686611) product Permease transl_table 11 codon_start 1 locus_tag LOCUS_06110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191874.1 CDS complement(686794..687216) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776018.1 CDS 687425..688591 product multidrug efflux MFS transporter NorA transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene norA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041274.1 CDS 688884..689336 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216725.1 CDS 689510..689992 product aminoacyl-tRNA deacylase transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene ybaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107235.1 CDS 690245..691006 product Lactose phosphotransferase system repressor transl_table 11 codon_start 1 locus_tag LOCUS_06160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557168.1 CDS 691003..691923 product 1-phosphofructokinase transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene fruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640737.1 CDS 691929..693887 product PTS fructose transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene fruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266553.1 CDS 694195..695376 product N-acetylglucosamine-6-phosphate deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_06190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 CDS 695597..696946 product HlyC/CorC family transporter transl_table 11 codon_start 1 locus_tag LOCUS_06200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450257.1 CDS 697168..698007 product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_06210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931238.1 CDS 698139..699122 product glycosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_06220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702778.1 CDS complement(699194..700249) product Histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene saeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244415.1 CDS complement(700249..700935) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_06240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149344.1 CDS complement(700910..701383) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037807.1 CDS complement(701725..702165) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093562.1 CDS complement(702445..703029) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604990.1 CDS complement(703128..703841) product 7-carboxy-7-deazaguanine synthase QueE transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene queE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062972.1 CDS complement(703845..704264) product 6-carboxytetrahydropterin synthase QueD transl_table 11 codon_start 1 locus_tag LOCUS_06290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941336.1 CDS complement(704266..704934) product 7-cyano-7-deazaguanine synthase QueC transl_table 11 codon_start 1 locus_tag LOCUS_06300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446724.1 CDS 705285..705878 product aminodeoxychorismate/anthranilate synthase component II transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene pabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604514.1 CDS 705862..707013 product para-aminobenzoate synthetase subunit I transl_table 11 codon_start 1 locus_tag LOCUS_06320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217796.1 CDS 707013..707621 product aminodeoxychorismate lyase transl_table 11 codon_start 1 locus_tag LOCUS_06330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175781.1 CDS 707687..707893 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797134.1 CDS 707981..708691 product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708690.1 CDS 708675..709679 product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022323.1 CDS 710153..712093 product lipoteichoic acid synthase transl_table 11 codon_start 1 locus_tag LOCUS_06370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098285.1 CDS 712370..714247 product ABC transporter, ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525106.1 CDS 714259..716040 product DNA helicase RecQ transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene recQ_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983677.1 CDS 716262..717239 product glycine/betaine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589248.1 CDS 717232..718746 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_06410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180991.1 CDS 718986..720044 product histidinol-phosphate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene hisC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663030.1 CDS 720395..720937 product 5'-3'-deoxyribonucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_06430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 CDS complement(721561..722478) product lipid kinase transl_table 11 codon_start 1 locus_tag LOCUS_06440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429006.1 CDS complement(722748..724253) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_06450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193751.1 CDS complement(724594..725094) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene queF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930014.1 CDS complement(725114..725980) product EamA/RhaT family transporter transl_table 11 codon_start 1 locus_tag LOCUS_06470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068501.1 CDS 726781..727179 product protein NrdI transl_table 11 codon_start 1 locus_tag LOCUS_06480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692521.1 CDS 727142..729247 product ribonucleotide-diphosphate reductase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_06490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855514.1 CDS 729365..730336 product ribonucleotide-diphosphate reductase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_06500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562498.1 CDS 731044..732015 product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_06510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876318.1 CDS 732002..732958 product Iron-regulated surface determinant protein F transl_table 11 codon_start 1 locus_tag LOCUS_06520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245577.1 CDS 732955..733716 product iron ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616840.1 CDS 733835..734863 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754443.1 CDS complement(735180..735494) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127269.1 CDS complement(735512..736435) product UDP-N-acetylenolpyruvoylglucosamine reductase transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene murB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608433.1 CDS complement(736562..737080) product GrpB family protein transl_table 11 codon_start 1 locus_tag LOCUS_06570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287207.1 CDS 737200..738078 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724887.1 CDS 738232..738552 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 CDS 738977..740101 product glycerate kinase transl_table 11 codon_start 1 locus_tag LOCUS_06600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866737.1 CDS complement(740290..741516) product peptidase T transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene pepT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795811.1 CDS complement(741530..742024) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_06620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899890.1 CDS complement(742042..742803) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_06630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113406.1 CDS complement(742999..744069) product GGDEF domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460983.1 CDS 744387..745442 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase transl_table 11 codon_start 1 locus_tag LOCUS_06650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 CDS complement(745612..746253) product YigZ family protein transl_table 11 codon_start 1 locus_tag LOCUS_06660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192949.1 CDS 746397..746780 product 6-phosphogluconate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_06670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 747144..748226 product comf operon protein 1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557172.1 CDS 748219..748893 product competence protein ComF transl_table 11 codon_start 1 locus_tag LOCUS_06690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057965.1 CDS 748954..749526 product ribosomal subunit interface protein transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene raiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617735.1 CDS 749940..752471 product preprotein translocase subunit SecA transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene secA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506531.1 CDS 752901..753896 product peptide chain release factor 2 transl_table 11 codon_start 1 locus_tag LOCUS_06720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967760.1 CDS 754305..755144 product tRNA-Arg transl_table 11 codon_start 1 locus_tag LOCUS_06730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753319.1 CDS 755318..755968 product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538141.1 CDS 755965..756201 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638419.1 CDS 756470..757501 product Excinuclease ABC, B subunit transl_table 11 codon_start 1 locus_tag LOCUS_06760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 757619..758527 product Transposase InsH for insertion sequence element IS5H transl_table 11 codon_start 1 locus_tag LOCUS_06770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CE54 CDS 758680..759654 product UvrABC system protein B transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene uvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 759662..762508 product excinuclease ABC subunit A transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene uvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662676.1 CDS 763170..764102 product HPr kinase/phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_06800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958224.1 CDS 764108..764947 product prolipoprotein diacylglyceryl transferase transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene lgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 CDS 764955..765440 product acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_06820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224793.1 CDS 765448..766887 product Anaphase-promoting complex, cyclosome, subunit 3 transl_table 11 codon_start 1 locus_tag LOCUS_06830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057543.1 CDS 766954..767889 product thioredoxin reductase transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene trxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134963.1 CDS 768883..769794 product RNase adaptor protein RapZ transl_table 11 codon_start 1 locus_tag LOCUS_06850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369722.1 CDS 769791..770786 product YvcK family protein transl_table 11 codon_start 1 locus_tag LOCUS_06860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248939.1 CDS 770896..771840 product sporulation regulator WhiA transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene whiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006551.1 tRNA complement(772154..772226) product YvcK family protein locus_tag LOCUS_t00120 inference COORDINATES:profile:Aragorn:1.2.38 CDS 772413..773000 product ATP-dependent Clp protease proteolytic subunit transl_table 11 codon_start 1 locus_tag LOCUS_06880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 CDS complement(773243..774145) product epimerase transl_table 11 codon_start 1 locus_tag LOCUS_06890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816304.1 CDS 774848..775477 product DUF4887 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070831.1 CDS 776119..777132 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_06910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654030.1 CDS 777185..778195 product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene gap_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279414.1 CDS 778334..779524 product phosphoglycerate kinase transl_table 11 codon_start 1 locus_tag LOCUS_06930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074749.1 CDS 779646..780407 product Triosephosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene tpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260089.1 CDS 780410..781927 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene gpmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085507.1 CDS 782057..783361 product enolase transl_table 11 codon_start 1 locus_tag LOCUS_06960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121760.1 CDS 783701..784159 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785252.1 CDS 784226..784459 product protein-export membrane protein SecG transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene secG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 CDS 784575..785315 product carboxylesterase transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene est inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165959.1 CDS 785349..787721 product ribonuclease R transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050048.1 CDS 787743..788207 product SsrA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 tmRNA 788298..788656 product hypothetical protein locus_tag LOCUS_tm00010 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(789529..789852) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058299.1 CDS complement(789868..790014) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057759.1 CDS complement(790206..790934) product DUF5067 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757397.1 CDS 791533..792054 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608192.1 CDS 792193..792723 product Acetyltransferase, GNAT family transl_table 11 codon_start 1 locus_tag LOCUS_07060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167158.1 CDS 792986..795769 product Clumping factor A transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene clfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 795990..796109 product Truncated secreted von Willebrand factor-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 796103 CDS 796106..797515 product coagulase transl_table 11 codon_start 1 locus_tag LOCUS_07090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791702.1 CDS 797866..798888 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728068.1 CDS 799223..799693 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene vwb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824482.1 CDS 800034..800720 product thermonuclease transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene nuc_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141557.1 CDS 801077..801277 product cold-shock protein transl_table 11 codon_start 1 locus_tag LOCUS_07130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059082.1 CDS complement(801773..801991) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005886.1 CDS complement(802053..802337) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004399.1 CDS complement(802425..802994) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106654.1 CDS complement(803182..803370) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052076.1 CDS complement(803399..803659) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059690.1 CDS 804000..804203 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145163.1 CDS complement(804200..804436) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349581.1 CDS 804661..805242 product Putative phosphoglycerate mutase family protein transl_table 11 codon_start 1 locus_tag LOCUS_07210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802951.1 CDS complement(805315..805932) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255551.1 CDS complement(806087..806581) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569884.1 CDS complement(806980..807402) product organic hydroperoxide reductase OsmC/OhrA transl_table 11 codon_start 1 locus_tag LOCUS_07240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974460.1 CDS 807550..808266 product 3-dehydroquinase transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene aroD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150011.1 CDS 808349..808888 product Nitroreductase transl_table 11 codon_start 1 locus_tag LOCUS_07260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422908.1 CDS complement(809038..809358) product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_07270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147952.1 CDS 809502..809858 product arsenate reductase transl_table 11 codon_start 1 locus_tag LOCUS_07280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589549.1 CDS 810016..810396 product glycine cleavage system protein H transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene gcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 CDS 810575..811453 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932225.1 CDS 812195..812581 product topiosmerase transl_table 11 codon_start 1 locus_tag LOCUS_07310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018962.1 CDS 812574..812870 product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_07320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065801.1 CDS 813120..814145 product methionine import ATP-binding protein MetN 2 transl_table 11 codon_start 1 locus_tag LOCUS_07330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571207.1 CDS 814138..814833 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_07340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520231.1 CDS 814851..815672 product methionine ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732324.1 CDS 816026..816220 product CsbD family protein transl_table 11 codon_start 1 locus_tag LOCUS_07360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752917.1 CDS complement(816453..817304) product DUF368 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 CDS 817632..818393 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene sufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168845.1 CDS 818491..819798 product Fe-S cluster assembly protein SufD transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene sufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205567.1 CDS 819913..821154 product aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_07400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006450.1 CDS 821144..821608 product iron-sulfur cluster assembly scaffold protein NifU transl_table 11 codon_start 1 locus_tag LOCUS_07410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010508.1 CDS 821759..823156 product Fe-S cluster assembly protein SufB transl_table 11 codon_start 1 locus_tag LOCUS_07420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 CDS complement(823486..823800) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274029.1 CDS 824165..825205 product HlyC/CorC family transporter transl_table 11 codon_start 1 locus_tag LOCUS_07440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582326.1 CDS 825219..826286 product nitronate monooxygenase transl_table 11 codon_start 1 locus_tag LOCUS_07450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267236.1 CDS 826499..827347 product DUF72 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608129.1 CDS 827360..828187 product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_07470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 CDS 828214..829533 product 5-nucleotidase family protein transl_table 11 codon_start 1 locus_tag LOCUS_07480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241246.1 CDS 829617..830534 product lipoyl synthase transl_table 11 codon_start 1 locus_tag LOCUS_07490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201875.1 CDS 830664..831047 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598444.1 CDS complement(831126..831392) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566649.1 CDS 831490..831924 product DUF86 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273982.1 CDS 831924..832703 product TIGR01457 family HAD-type hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_07530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816184.1 CDS 832736..833695 product D-glycerate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_07540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239131.1 CDS 834107..834259 product teichoic acid D-Ala incorporation-associated protein DltX transl_table 11 codon_start 1 locus_tag LOCUS_07550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837752.1 CDS 834275..835732 product D-alanine--poly(phosphoribitol) ligase transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene dltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129659.1 CDS 835729..836943 product D-alanyl-lipoteichoic acid biosynthesis protein DltB transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene dltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613541.1 CDS 836961..837197 product D-alanine--poly(phosphoribitol) ligase subunit 2 transl_table 11 codon_start 1 locus_tag LOCUS_07580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395692.1 CDS 837194..838369 product Lipoteichoic acid biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_07590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769415.1 CDS complement(838632..838874) product NifU family protein transl_table 11 codon_start 1 locus_tag LOCUS_07600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141883.1 CDS 838975..839298 product disulfide oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_07610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401414.1 CDS complement(839357..840421) product NADH dehydrogenase family protein transl_table 11 codon_start 1 locus_tag LOCUS_07620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794020.1 CDS 840738..840974 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068337.1 CDS 840987..841346 product iron-sulfur cluster assembly accessory protein transl_table 11 codon_start 1 locus_tag LOCUS_07640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 CDS 841800..843008 product NADH dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_07650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046076.1 CDS 843139..844614 product cytosol aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ampA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009692.1 CDS 845025..846341 product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_07670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606324.1 CDS 846360..846734 product thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_07680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149295.1 CDS complement(846790..847944) product pyridine nucleotide-disulfide oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_07690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 CDS complement(848193..848549) product Na+/H+ antiporter subunit G transl_table 11 codon_start 1 locus_tag LOCUS_07700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590451.1 CDS complement(848527..848820) product Na+/H+ antiporter subunit F transl_table 11 codon_start 1 locus_tag LOCUS_07710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016306.1 CDS complement(848820..849299) product Na+/H+ antiporter subunit E transl_table 11 codon_start 1 locus_tag LOCUS_07720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290674.1 CDS complement(849301..850797) product Na+/H+ antiporter subunit D transl_table 11 codon_start 1 locus_tag LOCUS_07730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573077.1 CDS complement(850790..851131) product Na(+)/H(+) antiporter subunit C1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443624.1 CDS complement(851131..851559) product Na+/H+ antiporter subunit B transl_table 11 codon_start 1 locus_tag LOCUS_07750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081626.1 CDS complement(851552..853957) product Na+/H+ antiporter subunit A transl_table 11 codon_start 1 locus_tag LOCUS_07760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054612.1 CDS complement(854088..854471) product kinase transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene kapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781162.1 CDS 854535..855128 product peptidyl-prolyl cis-trans isomerase transl_table 11 codon_start 1 locus_tag LOCUS_07780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035058.1 CDS 855544..855921 product general stress protein transl_table 11 codon_start 1 locus_tag LOCUS_07790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067294.1 CDS 856283..857410 product NADH-dependent flavin oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_07800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838029.1 CDS 857718..858908 product Ornithine aminotransferase 2 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene rocD_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 CDS 859017..860261 product NAD-specific glutamate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_07820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138487.1 repeat_region 860412..860694 rpt_family CRISPR rpt_type direct rpt_unit_seq aaagtcagcttacaatagtgtgcaagttgg inference COORDINATES:alignment:CRT:1.2 CDS complement(860764..861693) product glycerophosphodiester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene glpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185319.1 CDS complement(861935..863314) product argininosuccinate lyase transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene argH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066053.1 CDS complement(863304..864509) product argininosuccinate synthase transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene argG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660045.1 CDS 864860..866191 product Glucose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene pgi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148852.1 CDS 866516..867091 product TVP38/TMEM64 family protein transl_table 11 codon_start 1 locus_tag LOCUS_07870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007967.1 CDS 867096..867620 product inactive signal peptidase IA transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene spsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758209.1 CDS 867636..868211 product signal peptidase IB transl_table 11 codon_start 1 locus_tag LOCUS_07890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711896.1 CDS 868371..871847 product ATP-dependent helicase/deoxyribonuclease subunit B transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene addB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172350.1 CDS 871848..875501 product ATP-dependent helicase/nuclease subunit A transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene addA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154921.1 CDS 875667..876569 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670752.1 CDS 876898..877287 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902805.1 CDS complement(877458..878774) product CoA-disulfide reductase transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene cdr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124506.1 CDS complement(878826..879650) product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_07950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182436.1 CDS 879764..880072 product DNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390575.1 CDS 880619..882433 product O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044230.1 CDS 882636..885245 product Chaperone protein ClpB transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene clpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353954.1 CDS complement(885304..886173) product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_07990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047069.1 CDS 886283..887428 product 2-isopropylmalate synthase transl_table 11 codon_start 1 locus_tag LOCUS_08000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619360.1 CDS 887412..888053 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404422.1 CDS 888046..889164 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_08020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037440.1 CDS 889148..889663 product phosphatidylethanolamine-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700882.1 CDS 889974..890408 product MAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769694.1 CDS complement(890665..890850) product DUF2929 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682089.1 CDS 891145..892086 product 3-oxoacyl-ACP synthase III transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene fabH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100526.1 CDS 892098..893342 product beta-ketoacyl-[acyl-carrier-protein] synthase II transl_table 11 codon_start 1 locus_tag LOCUS_08070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081231.1 CDS complement(893397..893768) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_08080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915157.1 CDS 894011..894937 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene oppB_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521533.1 CDS 894937..896007 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene oppC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829632.1 CDS 896024..897106 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene oppD_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140050.1 CDS 897096..898037 product Oligopeptide ABC transporter, ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene oppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786734.1 CDS 898056..899711 product peptide ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene oppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197018.1 CDS 899923..901638 product Oligopeptide ABC transporter, substrate-binding protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_08140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517183.1 CDS 901689..902675 product peptide ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067052.1 CDS 902678..903658 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene oppD_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427767.1 CDS 903651..904613 product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene oppB_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915997.1 CDS 904625..905506 product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene oppC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180280.1 CDS complement(905548..906537) product tryptophan--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene trpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448934.1 CDS 906832..907227 product regulatory protein Spx transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene spxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258003.1 CDS 907598..908317 product adaptor protein MecA transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene mecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217728.1 CDS 908438..909424 product competence protein CoiA transl_table 11 codon_start 1 locus_tag LOCUS_08220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959282.1 CDS 909472..911280 product oligoendopeptidase F transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene pepF_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082725.1 CDS complement(911740..912546) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896697.1 CDS complement(912569..912934) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214070.1 CDS complement(913038..913631) product adenylate cyclase transl_table 11 codon_start 1 locus_tag LOCUS_08260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224619.1 CDS 913817..914164 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242103.1 CDS 914181..914816 product GTP pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_08280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077683.1 CDS 914833..915642 product NAD(+) kinase transl_table 11 codon_start 1 locus_tag LOCUS_08290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270834.1 CDS 915639..916493 product RNA pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_08300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669923.1 CDS 916514..917899 product magnesium transporter transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene mgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 CDS 917909..919753 product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_08320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395153.1 CDS 920031..920801 product Enoyl-[acyl-carrier-protein] reductase [NADPH] transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene fabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933195.1 CDS complement(920996..922081) product AI-2E family transporter transl_table 11 codon_start 1 locus_tag LOCUS_08340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933105.1 CDS 922423..923991 product Alanine:cation symporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_08350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570687.1 CDS 924133..924891 product esterase family protein transl_table 11 codon_start 1 locus_tag LOCUS_08360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288675.1 CDS 925085..925594 product tRNA-Ser transl_table 11 codon_start 1 locus_tag LOCUS_08370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600387.1 CDS complement(925707..926897) product MFS domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795273.1 CDS complement(926875..928050) product diacylglycerol beta-glucosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene ugtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258645.1 CDS 928483..929964 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene murE_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340119.1 CDS 929957..930208 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795833.1 CDS 930208..931770 product peptide chain release factor 3 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene prfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049950.1 CDS 932072..932875 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_08430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928413.1 CDS 933109..935418 product Serine protease HtrA-like transl_table 11 codon_start 1 locus_tag LOCUS_08440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795272.1 CDS 935435..936793 product Ktr system potassium uptake protein D transl_table 11 codon_start 1 locus_tag LOCUS_08450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021865.1 CDS 936932..938443 product bifunctional metallophosphatase/5'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_08460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414165.1 tRNA complement(938622..938712) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase locus_tag LOCUS_t00130 gene murE_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(938714..938788) product tRNA-Asn locus_tag LOCUS_t00140 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(938930..939499) product competence protein ComK transl_table 11 codon_start 1 locus_tag LOCUS_08470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287265.1 CDS 939709..939927 product IDEAL domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876826.1 CDS complement(940008..940994) product lipoate--protein ligase A transl_table 11 codon_start 1 locus_tag LOCUS_08490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668818.1 CDS 941193..941369 product DUF2187 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214898.1 CDS 941384..941986 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033865.1 CDS 943330..945294 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870829.1 CDS 945297..945617 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668627.1 CDS 945614..946255 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571167.1 CDS 946912..947199 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 947268..947912 product Glycosyltransferase family 1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 947905..948687 product Glycosyl transferase, group 1 family protein transl_table 11 codon_start 1 locus_tag LOCUS_08570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(948776..949132) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766009.1 CDS 949620..950579 product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081351.1 CDS complement(950820..951035) product TM2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 951200..951751 product acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620949.1 CDS complement(951802..952740) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene menA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070966.1 CDS 952922..954283 product Isochorismate synthase transl_table 11 codon_start 1 locus_tag LOCUS_08630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001816819.1 CDS 954270..955943 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene menD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526694.1 CDS 955930..956733 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene menH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150197.1 CDS 956726..957547 product 1,4-dihydroxy-2-naphthoyl-CoA synthase transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene menB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184945.1 CDS complement(957786..958115) product staphostatin B transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene sspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284458.1 CDS complement(958153..959334) product staphopain B transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene sspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089094.1 CDS complement(959416..960426) product serine protease transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene sspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676539.1 CDS complement(960954..962108) product Aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_08700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777577.1 CDS complement(962304..963314) product acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202433.1 CDS 963467..963886 product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_08720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278015.1 CDS complement(964093..967863) product Bifunctional autolysin transl_table 11 codon_start 1 locus_tag LOCUS_08730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074534.1 CDS complement(968091..968525) product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 CDS complement(968680..969150) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088431.1 CDS complement(969198..970415) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031978.1 CDS 970866..972059 product protein FmtA transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene fmt_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671245.1 CDS complement(972596..972874) product Quinol oxidase subunit 4 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene qoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104254.1 CDS complement(972883..973488) product quinol oxidase subunit 3 transl_table 11 codon_start 1 locus_tag LOCUS_08790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017736.1 CDS complement(973478..975466) product cytochrome ubiquinol oxidase subunit I transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene qoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010762.1 CDS complement(975466..976566) product quinol oxidase subunit 2 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene qoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032836.1 CDS complement(977138..977455) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037831.1 CDS complement(978261..979121) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene folD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225836.1 CDS 979322..979804 product N5-carboxyaminoimidazole ribonucleotide mutase transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene purE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072353889.1 CDS 979791..980915 product 5-(carboxyamino)imidazole ribonucleotide synthase transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene purK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010413.1 CDS 980919..981623 product phosphoribosylaminoimidazolesuccinocarboxamide synthase transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene purC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174053.1 CDS 981623..981886 product phosphoribosylformylglycinamidine synthase transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene purS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848350.1 CDS 981888..982559 product phosphoribosylformylglycinamidine synthase subunit PurQ transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene purQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666806.1 CDS 982552..984741 product phosphoribosylformylglycinamidine synthase subunit PurL transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene purL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032740.1 CDS 984720..986204 product amidophosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene purF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483720.1 CDS 986197..987225 product phosphoribosylformylglycinamidine cyclo-ligase transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene purM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030811.1 CDS 987228..987794 product phosphoribosylglycinamide formyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene purN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238669.1 CDS 987809..989287 product Bifunctional purine biosynthesis protein PurH transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene purH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709277.1 CDS 989309..990556 product Phosphoribosylamine--glycine ligase transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene purD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101899.1 CDS complement(990821..991627) product energy-coupling factor transporter transmembrane protein EcfT transl_table 11 codon_start 1 locus_tag LOCUS_08950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273253.1 CDS complement(991620..993020) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921965.1 CDS complement(993035..993610) product thiamine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033477.1 CDS complement(994194..994328) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene graF inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 994480..995775 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009069.1 CDS 996200..997372 product class I SAM-dependent rRNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685067.1 CDS 997426..997968 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505966.1 CDS 998122..998388 product phosphocarrier protein HPr transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene ptsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437472.1 CDS 998391..1000109 product phosphoenolpyruvate--protein phosphotransferase transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene ptsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040051.1 CDS complement(1000346..1000579) product NrdH-redoxin transl_table 11 codon_start 1 locus_tag LOCUS_09040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289618.1 CDS 1000777..1002138 product cytochrome ubiquinol oxidase subunit I transl_table 11 codon_start 1 locus_tag LOCUS_09050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381849.1 CDS 1002135..1003154 product cytochrome D ubiquinol oxidase subunit II transl_table 11 codon_start 1 locus_tag LOCUS_09060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638459.1 CDS 1003287..1003949 product potassium transporter Trk transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene trkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 CDS complement(1004298..1005995) product ribonuclease J 1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene rnj_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811375.1 CDS complement(1005995..1006213) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene rpoY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257888.1 CDS complement(1006694..1007245) product peptide deformylase transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene def_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957037.1 CDS 1007610..1008236 product cell-wall-binding lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_09110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668336.1 CDS 1008407..1009519 product pyruvate dehydrogenase E1 component subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene pdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035320.1 CDS 1009523..1010500 product pyruvate dehydrogenase E1 component subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene pdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068176.1 CDS 1010591..1011883 product Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex transl_table 11 codon_start 1 locus_tag LOCUS_09140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 CDS 1011887..1013293 product Dihydrolipoyl dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_09150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260117.1 CDS 1013461..1013736 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455597.1 CDS 1013880..1014419 product XRE family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_09170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020625.1 CDS 1014432..1015526 product spermidine/putrescine import ATP-binding protein PotA transl_table 11 codon_start 1 locus_tag LOCUS_09180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433551.1 CDS 1015519..1016316 product spermidine/putrescine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene potB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246555.1 CDS 1016322..1017131 product spermidine/putrescine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene potC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872390.1 CDS 1017131..1018204 product spermidine/putrescine ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene potD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819684.1 CDS 1018278..1019297 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145499.1 CDS 1019580..1019999 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_09230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080466.1 CDS complement(1020081..1021433) product divalent metal cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene mntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060842.1 CDS complement(1021617..1022231) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170603.1 CDS 1022388..1023215 product inositol monophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_09260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240318.1 CDS complement(1023369..1023560) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810620.1 CDS 1023662..1025509 product translational GTPase TypA transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene typA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182654.1 CDS complement(1025649..1025816) product DUF2197 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250275.1 CDS complement(1025818..1026300) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614712.1 CDS 1026441..1026716 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118417.1 CDS 1027030..1028256 product cell division protein FtsW transl_table 11 codon_start 1 locus_tag LOCUS_09320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787940.1 CDS 1028810..1032262 product pyruvate carboxylase transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene pycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809514.1 CDS complement(1032402..1033313) product Cytochrome c oxidase subunit XV assembly protein transl_table 11 codon_start 1 locus_tag LOCUS_09340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557321.1 CDS 1033753..1034664 product protoheme IX farnesyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene cyoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031401.1 CDS 1034689..1035150 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_09360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 CDS 1035477..1036514 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733409.1 CDS 1036530..1036964 product regulator transl_table 11 codon_start 1 locus_tag LOCUS_09380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606480.1 CDS complement(1037027..1037953) product glycerophosphodiester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_09390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757575.1 CDS 1038192..1038446 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049150.1 CDS complement(1038449..1038838) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814565.1 CDS 1038908..1039450 product methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263796.1 CDS 1039452..1039934 product phosphopantetheine adenylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 CDS complement(1039996..1041135) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene tmcAL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843611.1 CDS 1041262..1041819 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872158.1 CDS 1041899..1042030 product 50S ribosomal protein L32 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene rpmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1042227..1044164) product iron-regulated surface determinant protein B transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene isdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041583.1 CDS complement(1044368..1045420) product iron-regulated surface determinant protein A transl_table 11 codon_start 1 locus_tag LOCUS_09480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160859.1 CDS 1045629..1046312 product iron-regulated surface determinant protein C transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene isdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789821.1 CDS 1046312..1047388 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene isdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246685.1 CDS 1047385..1048263 product heme uptake system protein IsdE transl_table 11 codon_start 1 locus_tag LOCUS_09510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220199.1 CDS 1048276..1049052 product Iron-regulated surface determinant protein F transl_table 11 codon_start 1 locus_tag LOCUS_09520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548422.1 note frameshifted, insertion/deletion at around 1049031 CDS 1049037..1049240 product Iron-regulated surface determinant protein F transl_table 11 codon_start 1 locus_tag LOCUS_09530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1049031 CDS 1049302..1050036 product SrtB family sortase transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene srtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 CDS 1050055..1050378 product monooxygenase IsdI transl_table 11 codon_start 1 locus_tag LOCUS_09550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670950.1 CDS 1050762..1051502 product RNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435374.1 CDS 1051883..1052941 product phenylalanine--tRNA ligase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene pheS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003566.1 CDS 1052941..1055343 product phenylalanine--tRNA ligase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene pheT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908969.1 CDS complement(1055514..1056452) product ribonuclease HIII transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene rnhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284282.1 CDS 1056822..1057082 product Cell division protein ZapA transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene zapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VI53 CDS 1057168..1057611 product CvpA family protein transl_table 11 codon_start 1 locus_tag LOCUS_09610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234068.1 CDS 1057684..1059396 product DNA polymerase/3'-5' exonuclease PolX transl_table 11 codon_start 1 locus_tag LOCUS_09620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161938.1 CDS 1059406..1061754 product endonuclease MutS2 transl_table 11 codon_start 1 locus_tag LOCUS_09630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249275.1 CDS 1061927..1062241 product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_09640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 CDS 1062565..1064346 product excinuclease ABC subunit C transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene uvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390524.1 CDS 1064670..1065284 product succinate dehydrogenase cytochrome B558 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene sdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079317.1 CDS 1065336..1067102 product succinate dehydrogenase flavoprotein subunit transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene sdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818278.1 CDS 1067102..1067917 product succinate dehydrogenase iron-sulfur subunit transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene sdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 CDS 1068153..1068953 product glutamate racemase transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene murI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039659.1 CDS 1068965..1069552 product non-canonical purine NTP pyrophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_09700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659319.1 CDS 1069545..1070048 product Phosphoesterase transl_table 11 codon_start 1 locus_tag LOCUS_09710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049484.1 CDS 1070176..1070343 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791787.1 CDS 1070537..1070866 product fibrinogen-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_09730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739210.1 CDS 1070943..1071131 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1071235..1071636) product FPRL1 inhibitory protein transl_table 11 codon_start 1 locus_tag LOCUS_09750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739564.1 CDS 1072308..1072814 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584398.1 CDS 1073073..1073570 product fibrinogen-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene efb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791581.1 CDS 1073724..1074074 product fibrinogen-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_09780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669537.1 CDS complement(1074896..1075081) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032817.1 CDS complement(1075703..1075936) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231632.1 CDS complement(1076413..1077372) product alpha-hemolysin transl_table 11 codon_start 1 locus_tag LOCUS_09810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857488.1 CDS 1078175..1078372 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802045.1 CDS complement(1078816..1079532) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041897.1 CDS complement(1079640..1080365) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063553.1 CDS complement(1080460..1081185) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739531.1 CDS 1081623..1082624 product ornithine carbamoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene argF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793607.1 CDS 1082647..1083579 product carbamate kinase 1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074342.1 CDS 1083751..1085307 product YfcC family protein transl_table 11 codon_start 1 locus_tag LOCUS_09880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078056048.1 CDS 1085615..1085842 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149423.1 CDS complement(1086147..1087094) product permease transl_table 11 codon_start 1 locus_tag LOCUS_09900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239282.1 CDS 1087343..1087531 product tRNA-Arg transl_table 11 codon_start 1 locus_tag LOCUS_09910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245796.1 tRNA complement(1088005..1088080) product hypothetical protein locus_tag LOCUS_t00150 inference COORDINATES:profile:Aragorn:1.2.38 CDS 1088443..1088577 product hemolytic protein transl_table 11 codon_start 1 locus_tag LOCUS_09920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398672.1 CDS 1088634..1088768 product hemolytic protein transl_table 11 codon_start 1 locus_tag LOCUS_09930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147103.1 CDS 1088901..1089587 product noncanonical pyrimidine nucleotidase, YjjG family transl_table 11 codon_start 1 locus_tag LOCUS_09940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788648.1 CDS complement(1089696..1090136) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289711.1 CDS 1090331..1090558 product Bacillithiol biosynthesis cysteine-adding enzyme BshC transl_table 11 codon_start 1 locus_tag LOCUS_09960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1090537 CDS 1090591..1091952 product bacillithiol biosynthesis cysteine-adding enzyme BshC transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene bshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340465.1 note frameshifted, insertion/deletion at around 1090537 CDS 1092096..1092527 product division/cell wall cluster transcriptional repressor MraZ transl_table 11 codon_start 1 locus_tag LOCUS_09980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 CDS 1092543..1093478 product Methylase MraW transl_table 11 codon_start 1 locus_tag LOCUS_09990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468384.1 CDS 1093492..1093893 product cell division protein FtsL transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene ftsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257598.1 CDS 1093874..1096108 product penicillin-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene pbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118652.1 CDS 1096400..1097365 product phospho-N-acetylmuramoyl-pentapeptide-transferase transl_table 11 codon_start 1 locus_tag LOCUS_10020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578458.1 CDS 1097367..1098716 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene murD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935991.1 CDS 1098732..1100051 product cell division protein DivIB transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene divIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342182.1 CDS 1100157..1101569 product cell division protein FtsA transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene ftsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391031.1 CDS 1101602..1102774 product cell division protein FtsZ transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene ftsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888997.1 CDS 1103034..1103825 product laccase transl_table 11 codon_start 1 locus_tag LOCUS_10070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075111477.1 CDS 1103843..1104517 product YggS family pyridoxal phosphate enzyme transl_table 11 codon_start 1 locus_tag LOCUS_10080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548498.1 CDS 1104514..1105077 product cell division protein SepF transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene sepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018608.1 CDS 1105089..1105379 product cell division protein transl_table 11 codon_start 1 locus_tag LOCUS_10100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354114.1 CDS 1105462..1106268 product S4 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_10110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232511.1 CDS 1106292..1106909 product cell division protein DivIVA transl_table 11 codon_start 1 locus_tag LOCUS_10120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117064.1 CDS 1107130..1109883 product isoleucine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene ileS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384691.1 CDS 1109981..1110133 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1110173..1110970 product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_10150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274855.1 CDS complement(1111031..1111225) product Transposase transl_table 11 codon_start 1 locus_tag LOCUS_10160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1111794..1112285 product lipoprotein signal peptidase transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene lspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 CDS 1112285..1113202 product RluA family pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_10180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451294.1 CDS 1113602..1114129 product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003870.1 CDS 1114347..1115654 product uracil permease transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene pyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178619.1 CDS 1115682..1116563 product aspartate carbamoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016166.1 CDS 1116581..1117855 product dihydroorotase transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene pyrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767028.1 CDS 1117857..1118957 product carbamoyl-phosphate synthase small chain transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene carA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190913.1 CDS 1118950..1122123 product carbamoyl-phosphate synthase large chain transl_table 11 codon_start 1 locus_tag LOCUS_10240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126259.1 CDS 1122233..1122925 product orotidine-5'-phosphate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene pyrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654067.1 CDS 1122925..1123536 product orotate phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene pyrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040248.1 CDS 1123566..1123778 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998557.1 CDS 1124215..1124616 product VOC family protein transl_table 11 codon_start 1 locus_tag LOCUS_10280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354180.1 CDS complement(1124879..1126576) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene rqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312768.1 CDS 1126851..1127474 product guanylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene gmk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368226.1 CDS 1127474..1127692 product DNA-directed RNA polymerase subunit omega transl_table 11 codon_start 1 locus_tag LOCUS_10310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933956.1 CDS 1127908..1129107 product phosphopantothenoylcysteine decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene coaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 CDS 1129107..1131515 product primosomal protein N' transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene priA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560839.1 CDS 1132021..1132974 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751704.1 CDS complement(1133137..1133340) product TM2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_10350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1133639..1134127 product peptide deformylase transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene def_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985293.1 CDS 1134120..1135055 product methionyl-tRNA formyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene fmt_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161291.1 CDS 1135052..1136359 product 16S rRNA m5C967 methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572235.1 CDS 1136362..1137456 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN transl_table 11 codon_start 1 locus_tag LOCUS_10390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 CDS 1137463..1138206 product protein phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_10400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 CDS 1138203..1140197 product serine/threonine protein kinase transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene pknB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579563.1 CDS 1140425..1141300 product GTPase transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene rsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847936.1 CDS 1141301..1141945 product ribulose-phosphate 3-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene rpe inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164332.1 CDS 1141952..1142593 product thiamine pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_10440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547910.1 CDS complement(1142974..1143162) product 50S ribosomal protein L28 transl_table 11 codon_start 1 locus_tag LOCUS_10450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517908.1 CDS 1143605..1143979 product Asp23/Gls24 family envelope stress response protein transl_table 11 codon_start 1 locus_tag LOCUS_10460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 CDS 1143994..1145640 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623903.1 CDS 1145830..1147890 product DNA helicase RecG transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene recG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151509.1 CDS 1148108..1148665 product transcription factor transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene fapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548538.1 CDS 1148670..1149656 product phosphate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene plsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 CDS 1149649..1150575 product malonyl CoA-ACP transacylase transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene fabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047343.1 CDS 1150568..1151302 product beta-ketoacyl-ACP reductase transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene fabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 CDS 1151545..1151778 product acyl carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_10530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426914.1 CDS 1151894..1152625 product ribonuclease 3 transl_table 11 codon_start 1 locus_tag LOCUS_10540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043237.1 CDS 1152772..1156338 product chromosome segregation protein SMC transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262698.1 CDS 1156338..1157588 product signal recognition particle-docking protein FtsY transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene ftsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007678.1 CDS 1157575..1157907 product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_10570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531320.1 CDS 1157933..1159300 product signal recognition particle protein transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene ffh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 CDS 1159735..1160010 product 30S ribosomal protein S16 transl_table 11 codon_start 1 locus_tag LOCUS_10590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268754.1 CDS 1160198..1160701 product Ribosome maturation factor RimM transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 CDS 1160701..1161438 product tRNA (guanosine(37)-N1)-methyltransferase TrmD transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene trmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 CDS 1161541..1161891 product 50S ribosomal protein L19 transl_table 11 codon_start 1 locus_tag LOCUS_10620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 CDS complement(1162135..1163493) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_10630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1165142..1166026 product ribosome biogenesis GTPase YlqF transl_table 11 codon_start 1 locus_tag LOCUS_10640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236726.1 CDS 1166010..1166777 product ribonuclease HII transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene rnhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176393.1 CDS 1166886..1168052 product succinyl-CoA ligase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_10660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020801.1 CDS 1168074..1168982 product succinyl-CoA ligase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene sucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 CDS 1169209..1170327 product cell wall hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene lytN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041666.1 CDS 1170355..1171599 product aminoacyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672869.1 CDS 1171772..1172644 product DNA protecting protein DprA transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene dprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800825.1 CDS 1172818..1174893 product DNA topoisomerase I transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene topA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557331.1 CDS 1175049..1176356 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene trmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195254.1 CDS 1176773..1177669 product tyrosine recombinase XerC transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene xerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015601.1 CDS 1177666..1178211 product HslU--HslV peptidase proteolytic subunit transl_table 11 codon_start 1 locus_tag LOCUS_10740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072681.1 CDS 1178277..1179680 product HslU--HslV peptidase ATPase subunit transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene hslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379044.1 CDS 1179705..1180478 product GTP-sensing pleiotropic transcriptional regulator CodY transl_table 11 codon_start 1 locus_tag LOCUS_10760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055337.1 CDS 1180899..1181588 product 30S ribosomal protein S2 transl_table 11 codon_start 1 locus_tag LOCUS_10770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268484.1 note frameshifted, insertion/deletion at around 1180885 CDS 1181770..1182651 product Translation elongation factor Ts transl_table 11 codon_start 1 locus_tag LOCUS_10780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 CDS 1182788..1183510 product UMP kinase transl_table 11 codon_start 1 locus_tag LOCUS_10790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057330.1 CDS 1183529..1184083 product ribosome-recycling factor transl_table 11 codon_start 1 locus_tag LOCUS_10800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280006.1 CDS 1184456..1185226 product isoprenyl transferase transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene uppS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 CDS 1185233..1186015 product phosphatidate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene cdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868413.1 CDS 1186252..1187538 product RIP metalloprotease RseP transl_table 11 codon_start 1 locus_tag LOCUS_10830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121119.1 CDS 1187558..1189261 product proline--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene proS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814094.1 CDS 1189519..1193835 product DNA polymerase III subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene polC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801936.1 CDS 1194125..1194592 product ribosome maturation factor transl_table 11 codon_start 1 locus_tag LOCUS_10860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036633.1 CDS 1194613..1195788 product transcription termination/antitermination protein NusA transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene nusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097460.1 CDS 1195809..1196093 product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_10880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727423.1 CDS 1196090..1196407 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 CDS 1196412..1198529 product translation initiation factor IF-2 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene infB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043635.1 CDS 1198915..1199265 product ribosome-binding factor A transl_table 11 codon_start 1 locus_tag LOCUS_10910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 CDS 1199434..1200351 product tRNA pseudouridine(55) synthase TruB transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene truB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282298.1 CDS 1200366..1201337 product bifunctional riboflavin kinase/FMN adenylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene ribF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864185.1 CDS 1201452..1201721 product 30S ribosomal protein S15 transl_table 11 codon_start 1 locus_tag LOCUS_10940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 CDS 1202091..1204187 product polyribonucleotide nucleotidyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene pnp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076690.1 CDS 1204423..1206096 product ribonuclease J 2 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene rnj_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052590.1 CDS 1206352..1208721 product DNA translocase FtsK transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ftsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001811366.1 CDS 1208726..1209439 product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_10980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293312.1 CDS 1209470..1210735 product peptidase M16 transl_table 11 codon_start 1 locus_tag LOCUS_10990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089941.1 CDS 1210735..1212021 product Insulinase family protein transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene ymfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664775.1 CDS 1212021..1212725 product 3-oxoacyl-ACP reductase transl_table 11 codon_start 1 locus_tag LOCUS_11010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646228.1 CDS 1212830..1213657 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214890.1 CDS 1213676..1214068 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_11030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859443.1 CDS 1214102..1214680 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene pgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025093.1 CDS 1214907..1216058 product competence protein CinA transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene cinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020347.1 CDS 1216223..1217266 product DNA recombination/repair protein RecA transl_table 11 codon_start 1 locus_tag LOCUS_11060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368166.1 CDS 1217620..1219179 product ribonuclease Y transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene rny inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050913.1 CDS complement(1219476..1219691) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026308.1 CDS 1219865..1220662 product metallophosphoesterase transl_table 11 codon_start 1 locus_tag LOCUS_11090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222105.1 CDS 1220802..1222562 product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_11100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804320.1 CDS 1222563..1223429 product 2-oxoglutarate ferredoxin oxidoreductase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene korB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190138.1 CDS 1223523..1223816 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655666.1 CDS 1223950..1225494 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene miaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001524.1 CDS 1225495..1225860 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene ymcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282386.1 CDS 1225887..1226378 product energy coupling factor transporter S component ThiW transl_table 11 codon_start 1 locus_tag LOCUS_11150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842277.1 CDS 1226681..1229299 product DNA mismatch repair protein MutS transl_table 11 codon_start 1 locus_tag LOCUS_11160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073352.1 CDS 1229312..1231321 product DNA mismatch repair protein MutL transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene mutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516269.1 CDS 1231327..1231869 product glycerol-3-phosphate responsive antiterminator transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene glpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077635.1 CDS 1232334..1233152 product aquaporin family protein transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene glpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 CDS 1233281..1234777 product glycerol kinase transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene glpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417372.1 CDS 1234935..1236608 product Glycerol-3-phosphate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_11210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 CDS 1236758..1237672 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_11220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136952.1 CDS 1237690..1238625 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene miaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548613.1 CDS 1238640..1238873 product RNA-binding protein Hfq transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561358.1 CDS complement(1239095..1239571) product glutathione peroxidase transl_table 11 codon_start 1 locus_tag LOCUS_11250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448078.1 CDS 1239683..1240921 product GTPase HflX transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene hflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068617.1 CDS 1240940..1242178 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 CDS 1242421..1242789 product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene glnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624945.1 CDS 1242808..1244148 product glutamine synthetase transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene glnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 CDS 1244641..1244838 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793526.1 CDS 1245539..1245751 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795785.1 CDS 1246045..1246251 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002340.1 CDS 1247490..1247675 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006110.1 CDS 1248420..1248671 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956747.1 CDS 1248717..1249301 product phage head morphogenesis protein transl_table 11 codon_start 1 locus_tag LOCUS_11350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1249422..1249670 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1249947..1250213 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1250222..1250347 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1250775..1251065 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 1251076..1251270 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1251320..1251661 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1251668..1251859 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053372.1 CDS complement(1251843..1251995) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1252408..1253433) product low specificity L-threonine aldolase transl_table 11 codon_start 1 locus_tag LOCUS_11440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 CDS 1253703..1253900 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435068.1 CDS 1253958..1255439 product cardiolipin synthase transl_table 11 codon_start 1 locus_tag LOCUS_11460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270822.1 CDS 1255623..1256522 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_11470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593436.1 CDS 1256491..1257222 product multidrug ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_11480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603970.1 CDS 1257226..1258317 product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_11490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670307.1 CDS 1258314..1258916 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_11500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202390.1 CDS complement(1259029..1259217) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027143.1 CDS 1259356..1259889 product thermonuclease transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene nuc_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 CDS complement(1260032..1260886) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011826.1 CDS 1261208..1261792 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001803470.1 CDS complement(1261846..1263228) product aspartate kinase transl_table 11 codon_start 1 locus_tag LOCUS_11550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868645.1 CDS 1263419..1264699 product homoserine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_11560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735864.1 CDS 1264705..1265766 product threonine synthase transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene thrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255461.1 CDS 1265768..1266682 product homoserine kinase transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene thrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073180.1 CDS 1266740..1267543 product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_11590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186309.1 CDS complement(1267836..1268150) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580201.1 CDS complement(1268368..1269822) product gamma-aminobutyrate permease transl_table 11 codon_start 1 locus_tag LOCUS_11610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389956.1 CDS 1270026..1271543 product catalase transl_table 11 codon_start 1 locus_tag LOCUS_11620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082539.1 CDS 1271634..1271783 product 50S ribosomal protein L33 transl_table 11 codon_start 1 locus_tag LOCUS_11630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 CDS 1272237..1272506 product 30S ribosomal protein S14 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085655.1 CDS 1272663..1273640 product guanosine monophosphate reductase transl_table 11 codon_start 1 locus_tag LOCUS_11650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688122.1 CDS 1273815..1274678 product secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_11660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380730.1 CDS complement(1275058..1275681) product LexA repressor transl_table 11 codon_start 1 locus_tag LOCUS_11670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 CDS 1275824..1276057 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499650.1 CDS 1276193..1276432 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 CDS 1276553..1278541 product Transketolase transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene tkt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481443.1 CDS 1278819..1279061 product UPF0154 protein M013TW_1291 transl_table 11 codon_start 1 locus_tag LOCUS_11710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548645.1 CDS 1279240..1279707 product Cytochrome c biosynthesis protein, CcdC transl_table 11 codon_start 1 locus_tag LOCUS_11720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966142.1 CDS 1279831..1280952 product exonuclease sbcCD subunit D transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene sbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691301.1 CDS 1280956..1283799 product Nuclease SbcCD subunit C transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene sbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803135.1 CDS complement(1284057..1284419) product large-conductance mechanosensitive channel transl_table 11 codon_start 1 locus_tag LOCUS_11750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910489.1 CDS 1284623..1286269 product Glycine betaine transporter opuD transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene opuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088978.1 CDS 1287161..1289866 product aconitate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene acnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729744.1 CDS 1290046..1290513 product 4-hydroxybenzoyl-CoA thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_11780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640487.1 CDS complement(1290720..1291016) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165377.1 CDS complement(1291392..1292000) product glycerol-3-phosphate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene plsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972779.1 CDS 1292200..1294197 product DNA topoisomerase 4 subunit B transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene parE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557340.1 CDS 1294197..1296599 product DNA topoisomerase 4 subunit A transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene parC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289562.1 CDS 1296849..1298309 product alanine:cation symporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_11830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651160.1 CDS 1298809..1299660 product protein GlcT transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene glcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505015.1 CDS 1299795..1301003 product AI-2E family transporter transl_table 11 codon_start 1 locus_tag LOCUS_11850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004752.1 CDS 1301484..1304006 product phosphatidylglycerol lysyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene fmtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071136.1 CDS complement(1304209..1304673) product Peptide methionine sulfoxide reductase MsrA transl_table 11 codon_start 1 locus_tag LOCUS_11870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024830.1 CDS 1304855..1305838 product regulatory protein MsrR transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene msrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356975.1 CDS complement(1305926..1306111) product tautomerase transl_table 11 codon_start 1 locus_tag LOCUS_11890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123276.1 CDS 1306259..1307521 product DNA repair protein MucB transl_table 11 codon_start 1 locus_tag LOCUS_11900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283016.1 CDS complement(1307658..1308749) product Prephenate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_11910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214278.1 CDS 1308914..1309945 product Simila to deblocking aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_11920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433354.1 CDS 1310437..1311843 product anthranilate synthase component I transl_table 11 codon_start 1 locus_tag LOCUS_11930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350970.1 CDS 1311840..1312406 product glutamine amidotransferase transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene trpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604816.1 CDS 1312412..1313410 product anthranilate phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene trpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173833.1 CDS 1313412..1314194 product Indole-3-glycerol phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene trpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153613.1 CDS 1314191..1314826 product N-(5'-phosphoribosyl)anthranilate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene trpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768192.1 CDS 1314819..1316033 product tryptophan synthase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene trpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041351.1 CDS 1316026..1316754 product tryptophan synthase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene trpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163628.1 CDS 1317076..1318338 product aminoacyltransferase FemA transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene femA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673315.1 CDS 1318357..1319616 product aminoacyltransferase FemB transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene femB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673098.1 CDS 1320299..1321066 product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213021.1 CDS complement(1321114..1321587) product SWIM zinc finger family protein transl_table 11 codon_start 1 locus_tag LOCUS_12030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523668.1 CDS complement(1321711..1322412) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571259.1 CDS complement(1322405..1323178) product peptide ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052315.1 CDS complement(1323165..1323995) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_12060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548936.1 CDS complement(1323988..1324974) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_12070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469951.1 CDS complement(1325278..1325622) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171798.1 CDS 1325827..1327641 product oligoendopeptidase F transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene pepF_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077571.1 CDS complement(1327781..1328422) product phosphate transport system regulatory protein PhoU transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene phoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974847.1 CDS complement(1328429..1329280) product phosphate ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene pstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079447.1 CDS complement(1329327..1330244) product phosphate ABC transporter, permease protein PstA transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene pstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450297.1 CDS complement(1330246..1331172) product phosphate ABC transporter permease subunit PstC transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene pstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204619.1 CDS complement(1331363..1332346) product phosphate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene pstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759232.1 CDS 1332886..1333182 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_12150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874022.1 CDS complement(1333318..1334220) product virulence factor B transl_table 11 codon_start 1 locus_tag LOCUS_12160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162352.1 CDS 1334367..1335968 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942303.1 CDS 1336828..1338033 product aspartate kinase transl_table 11 codon_start 1 locus_tag LOCUS_12180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258716.1 CDS 1338097..1339086 product aspartate-semialdehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene asd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163523.1 CDS 1339088..1339975 product 4-hydroxy-tetrahydrodipicolinate synthase transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene dapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149278.1 CDS 1339972..1340694 product 4-hydroxy-tetrahydrodipicolinate reductase transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene dapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698231.1 CDS 1340721..1341440 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene dapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249839.1 CDS 1341583..1342734 product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003789.1 CDS 1342739..1343824 product alanine racemase 2 transl_table 11 codon_start 1 locus_tag LOCUS_12240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127595.1 CDS 1343814..1345079 product Diaminopimelate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene lysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216946.1 CDS complement(1345319..1345720) product protein msa transl_table 11 codon_start 1 locus_tag LOCUS_12260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876201.1 CDS complement(1345917..1346117) product cold-shock protein CspA transl_table 11 codon_start 1 locus_tag LOCUS_12270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 CDS complement(1346288..1346596) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269923.1 CDS 1346759..1347028 product acylphosphatase transl_table 11 codon_start 1 locus_tag LOCUS_12290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215907.1 CDS 1347089..1347676 product MW1293 protein transl_table 11 codon_start 1 locus_tag LOCUS_12300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788788.1 CDS 1347708..1348844 product tellurite resistance protein TelA transl_table 11 codon_start 1 locus_tag LOCUS_12310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138415.1 CDS complement(1349111..1349503) product Truncated transposase transl_table 11 codon_start 1 locus_tag LOCUS_12320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1349140,1349053,1348927 CDS complement(1349856..1351199) product branched-chain amino acid transport system II carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_12330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 CDS complement(1351424..1353310) product nitric oxide reductase activation protein NorD transl_table 11 codon_start 1 locus_tag LOCUS_12340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283678.1 CDS complement(1353324..1354115) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185421.1 CDS complement(1354296..1354499) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene yozC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902175.1 CDS complement(1354528..1355337) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334518.1 CDS complement(1355917..1357185) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex transl_table 11 codon_start 1 locus_tag LOCUS_12380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115439.1 CDS complement(1357199..1359997) product 2-oxoglutarate dehydrogenase E1 component transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene odhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180673.1 CDS complement(1360281..1361636) product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene arlS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166801.1 CDS complement(1361633..1362292) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_12410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192137.1 CDS complement(1362762..1362962) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184336.1 CDS complement(1363079..1363693) product phosphatase PAP2 family protein transl_table 11 codon_start 1 locus_tag LOCUS_12430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084769.1 CDS complement(1363710..1364780) product undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene murG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160906.1 CDS complement(1364792..1365301) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620194.1 CDS complement(1365701..1367191) product serine protease transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene ctpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342131.1 CDS complement(1367383..1367604) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801007.1 CDS complement(1367604..1368104) product glucose-specific phosphotransferase enzyme IIA component transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene crr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473653.1 CDS complement(1368116..1368544) product peptide-methionine (R)-S-oxide reductase transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene msrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913317.1 CDS complement(1368537..1369070) product peptide-methionine (S)-S-oxide reductase transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene msrA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159900.1 CDS complement(1369156..1369995) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166063.1 CDS complement(1370010..1370489) product dihydrofolate reductase transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene folA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175746.1 CDS complement(1370689..1371645) product thymidylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_12530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934894.1 CDS complement(1372069..1372506) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995287.1 CDS complement(1372522..1373646) product virulence factor C transl_table 11 codon_start 1 locus_tag LOCUS_12550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404645.1 CDS complement(1373684..1373935) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691942.1 CDS complement(1373947..1374141) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001838183.1 CDS 1374386..1375090 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_12580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282171.1 CDS complement(1375155..1375286) product Nitrogen regulation protein NIFR3 transl_table 11 codon_start 1 locus_tag LOCUS_12590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1375631..1376032 product ribonuclease H transl_table 11 codon_start 1 locus_tag LOCUS_12600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062946.1 CDS complement(1376091..1404698) product ECM-binding protein homolog transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene ebh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP76 CDS complement(1405096..1406487) product quinolone resistance protein NorB transl_table 11 codon_start 1 locus_tag LOCUS_12620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414695.1 CDS complement(1406644..1407966) product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_12630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064778.1 CDS complement(1407997..1409037) product serine/threonine dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_12640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210817.1 CDS complement(1409132..1410250) product Alanine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_12650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 CDS complement(1410725..1411603) product 5'-3' exonuclease transl_table 11 codon_start 1 locus_tag LOCUS_12660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133021.1 CDS complement(1411623..1415063) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608509.1 CDS 1415367..1416707 product PepSY domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene cysJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798987.1 CDS complement(1416913..1417245) product Putative exported protein transl_table 11 codon_start 1 locus_tag LOCUS_12690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516798.1 CDS complement(1417329..1418474) product RNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487154.1 CDS complement(1419125..1419469) product cell cycle protein GpsB transl_table 11 codon_start 1 locus_tag LOCUS_12710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286320.1 CDS complement(1419483..1420046) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241308.1 CDS complement(1420039..1420389) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000806.1 CDS complement(1420444..1420623) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788819.1 CDS 1420929..1421555 product Holliday junction resolvase RecU transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene recU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795446.1 CDS 1421552..1423735 product penicillin-binding protein 2 transl_table 11 codon_start 1 locus_tag LOCUS_12760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138336.1 CDS complement(1424301..1424642) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182021.1 CDS complement(1424647..1425306) product endonuclease III transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene nth inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253765.1 CDS complement(1425296..1425982) product chromosome replication protein DnaD transl_table 11 codon_start 1 locus_tag LOCUS_12790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362218.1 CDS complement(1426310..1427602) product asparagine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene asnS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858779.1 CDS complement(1427924..1430617) product ATP-dependent helicase DinG transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene dinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525078.1 CDS complement(1430641..1431612) product Bifunctional ligase/repressor BirA transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene birA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049921.1 CDS complement(1431599..1432801) product CCA-adding enzyme transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361540.1 CDS complement(1432806..1433948) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA transl_table 11 codon_start 1 locus_tag LOCUS_12840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690025.1 CDS complement(1434189..1434506) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839926.1 CDS complement(1434843..1435541) product Neutral zinc metallopeptidase family protein transl_table 11 codon_start 1 locus_tag LOCUS_12860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001827022.1 CDS complement(1435595..1436182) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_12870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154683.1 CDS complement(1436172..1436747) product UPF0302 protein RK64_07855 transl_table 11 codon_start 1 locus_tag LOCUS_12880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005212.1 CDS complement(1436761..1438005) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831060.1 CDS complement(1438012..1439310) product 3-phosphoshikimate 1-carboxyvinyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene aroA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253231.1 CDS complement(1439320..1440384) product 3-dehydroquinate synthase transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene aroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776312.1 CDS complement(1440410..1441576) product chorismate synthase transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene aroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269921.1 CDS complement(1441962..1442162) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789522.1 CDS complement(1442371..1442820) product nucleoside-diphosphate kinase transl_table 11 codon_start 1 locus_tag LOCUS_12940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442480.1 CDS complement(1442912..1443856) product heptaprenyl diphosphate synthase subunit II transl_table 11 codon_start 1 locus_tag LOCUS_12950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817755.1 CDS complement(1443873..1444598) product demethylmenaquinone methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene ubiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 CDS complement(1444601..1445173) product heptaprenyl pyrophosphate synthase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_12970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450555.1 CDS complement(1445604..1445876) product DNA-binding protein HU transl_table 11 codon_start 1 locus_tag LOCUS_12980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 CDS complement(1446047..1447045) product glycerol-3-phosphate dehydrogenase (NAD(P)(+)) transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene gpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 CDS complement(1447062..1448372) product ribosome biogenesis GTPase Der transl_table 11 codon_start 1 locus_tag LOCUS_13000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 CDS complement(1448594..1449769) product 30S ribosomal protein S1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene rpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133961.1 CDS complement(1450026..1450217) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800578.1 CDS complement(1450481..1451140) product cytidylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene cmk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644391.1 CDS 1451217..1452185 product L-asparaginase transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene ansA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681757.1 CDS complement(1452300..1453286) product thioredoxin reductase transl_table 11 codon_start 1 locus_tag LOCUS_13050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174258.1 CDS complement(1453688..1455148) product elastin-binding protein EbpS transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene ebpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069289.1 CDS complement(1455301..1456680) product ATP-dependent DNA helicase RecQ transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene recQ_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902099.1 CDS complement(1456670..1457623) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163801.1 CDS 1457731..1457979 product ferredoxin transl_table 11 codon_start 1 locus_tag LOCUS_13090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151997.1 CDS complement(1458085..1458630) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 CDS complement(1459227..1460141) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913243.1 CDS complement(1460156..1460362) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1460355..1461245) product DUF1672 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_13130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557355.1 CDS complement(1461363..1462280) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476346.1 CDS complement(1462371..1462718) product Lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_13150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1462963..1463799) product ORF014 transl_table 11 codon_start 1 locus_tag LOCUS_13160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1463920..1464057) product ORF103 transl_table 11 codon_start 1 locus_tag LOCUS_13170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1464415..1465869) product ORF007 transl_table 11 codon_start 1 locus_tag LOCUS_13180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1465880..1466182) product Gp59 transl_table 11 codon_start 1 locus_tag LOCUS_13190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1466318..1466617) product Gp58 transl_table 11 codon_start 1 locus_tag LOCUS_13200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466784.1 CDS complement(1466663..1466827) product Gp57 transl_table 11 codon_start 1 locus_tag LOCUS_13210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782200.1 CDS complement(1466820..1467209) product Gp56 transl_table 11 codon_start 1 locus_tag LOCUS_13220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1467209..1468675) product SLT orf 488-like protein transl_table 11 codon_start 1 locus_tag LOCUS_13230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1468675..1470585) product ORF004 transl_table 11 codon_start 1 locus_tag LOCUS_13240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369014.1 CDS complement(1470601..1470891) product ORF043 transl_table 11 codon_start 1 locus_tag LOCUS_13250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1470891..1472474) product SLT orf 527-like protein transl_table 11 codon_start 1 locus_tag LOCUS_13260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1472483..1473307) product ORF014 transl_table 11 codon_start 1 locus_tag LOCUS_13270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911828.1 CDS complement(1473307..1479507) product ORF001 transl_table 11 codon_start 1 locus_tag LOCUS_13280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1479521..1479679) product Gp49 transl_table 11 codon_start 1 locus_tag LOCUS_13290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1479721..1480071) product Gp48 transl_table 11 codon_start 1 locus_tag LOCUS_13300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1480129..1480584) product ORF028 transl_table 11 codon_start 1 locus_tag LOCUS_13310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1480676..1481317) product Gp46 transl_table 11 codon_start 1 locus_tag LOCUS_13320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1481352..1481747) product Gp45 transl_table 11 codon_start 1 locus_tag LOCUS_13330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1481748..1482149) product ORF034 transl_table 11 codon_start 1 locus_tag LOCUS_13340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1482146..1482478) product Gp43 transl_table 11 codon_start 1 locus_tag LOCUS_13350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1482490..1482768) product Gp42 transl_table 11 codon_start 1 locus_tag LOCUS_13360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1482837..1484000) product Gp41 transl_table 11 codon_start 1 locus_tag LOCUS_13370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475947.1 CDS complement(1484012..1484785) product Gp40 transl_table 11 codon_start 1 locus_tag LOCUS_13380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0JQM5 CDS complement(1484769..1486007) product Phage portal protein, HK97 family transl_table 11 codon_start 1 locus_tag LOCUS_13390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965198.1 CDS complement(1486012..1487703) product Phage terminase, large subunit, putative transl_table 11 codon_start 1 locus_tag LOCUS_13400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965199.1 CDS complement(1487693..1487998) product ORF043 transl_table 11 codon_start 1 locus_tag LOCUS_13410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1488120..1488434) product SLT orf 104b-like protein transl_table 11 codon_start 1 locus_tag LOCUS_13420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475942.1 CDS complement(1488591..1489028) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_13430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1489041..1490399) product ORF008 transl_table 11 codon_start 1 locus_tag LOCUS_13440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714183.1 CDS complement(1490389..1490679) product ORF044 transl_table 11 codon_start 1 locus_tag LOCUS_13450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 CDS complement(1491020..1491310) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_13460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1491243..1491503) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_13470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1491472..1493469) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_13480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 note frameshifted, insertion/deletion at around 1491272,1491477 CDS complement(1493521..1493721) product Gp31 transl_table 11 codon_start 1 locus_tag LOCUS_13490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1493789..1493941) product ORF090 transl_table 11 codon_start 1 locus_tag LOCUS_13500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595265.1 CDS complement(1493944..1494144) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1494119..1494307) product ORF079 transl_table 11 codon_start 1 locus_tag LOCUS_13520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1494344..1494886) product ORF026 transl_table 11 codon_start 1 locus_tag LOCUS_13530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181819.1 CDS complement(1494891..1495127) product ORF065 transl_table 11 codon_start 1 locus_tag LOCUS_13540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065108.1 CDS complement(1495120..1495428) product ORF041 transl_table 11 codon_start 1 locus_tag LOCUS_13550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1495425..1495772) product ORF046 transl_table 11 codon_start 1 locus_tag LOCUS_13560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286547.1 CDS complement(1495769..1496170) product 77ORF030 transl_table 11 codon_start 1 locus_tag LOCUS_13570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1496173..1496379) product ORF073 transl_table 11 codon_start 1 locus_tag LOCUS_13580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1496393..1496635) product ORF050 transl_table 11 codon_start 1 locus_tag LOCUS_13590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131382.1 CDS complement(1496650..1496850) product ORF068 transl_table 11 codon_start 1 locus_tag LOCUS_13600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1496853..1497110) product ORF048 transl_table 11 codon_start 1 locus_tag LOCUS_13610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111491.1 CDS complement(1497110..1497511) product ORF026 transl_table 11 codon_start 1 locus_tag LOCUS_13620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140289.1 CDS complement(1497511..1497696) product Gp18 transl_table 11 codon_start 1 locus_tag LOCUS_13630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1497709..1499670) product DNA-directed DNA polymerase transl_table 11 codon_start 1 locus_tag LOCUS_13640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 CDS complement(1499730..1500287) product ORF022 transl_table 11 codon_start 1 locus_tag LOCUS_13650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1500313..1501479) product ORF012 transl_table 11 codon_start 1 locus_tag LOCUS_13660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714175.1 CDS complement(1501476..1501838) product ORF032 transl_table 11 codon_start 1 locus_tag LOCUS_13670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1501853..1502176) product Gp13 transl_table 11 codon_start 1 locus_tag LOCUS_13680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1502255..1502416) product ORF092 transl_table 11 codon_start 1 locus_tag LOCUS_13690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048129.1 CDS complement(1502429..1502692) product ORF047 transl_table 11 codon_start 1 locus_tag LOCUS_13700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1502717..1502932) product Orf71 transl_table 11 codon_start 1 locus_tag LOCUS_13710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1502987..1503352 product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_13720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1503321..1503566) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_13730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1503582..1503845) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854072.1 CDS 1503978..1504691 product XRE family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031454.1 CDS 1504707..1505639 product ATP-dependent helicase transl_table 11 codon_start 1 locus_tag LOCUS_13760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759682.1 CDS 1505645..1505986 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591749.1 CDS 1506190..1506372 product 77ORF085 transl_table 11 codon_start 1 locus_tag LOCUS_13780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694772.1 CDS 1506430..1506555 product ORF136 transl_table 11 codon_start 1 locus_tag LOCUS_13790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1506552..1507166) product Na/K ATPase transl_table 11 codon_start 1 locus_tag LOCUS_13800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1507292..1508497 product Integrase transl_table 11 codon_start 1 locus_tag LOCUS_13810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CI63 CDS complement(1508540..1510567) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033761.1 CDS complement(1510560..1511489) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476346.1 CDS complement(1511734..1513485) product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene srrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987774.1 CDS complement(1513466..1514191) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene srrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064078.1 CDS complement(1514324..1515061) product rRNA pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159577.1 CDS complement(1515054..1515596) product SMC-Scp complex subunit ScpB transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene scpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368656.1 CDS complement(1515589..1516320) product segregation and condensation protein A transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene scpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273371.1 CDS 1516412..1516918 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183429.1 CDS complement(1516996..1517883) product tyrosine recombinase XerD transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene xerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 CDS complement(1517932..1518381) product transcriptional repressor transl_table 11 codon_start 1 locus_tag LOCUS_13910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392691.1 CDS complement(1518486..1519028) product NUDIX hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_13920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 CDS 1519110..1520018 product Oxidoreductase, aldo/keto reductase family transl_table 11 codon_start 1 locus_tag LOCUS_13930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171335.1 CDS complement(1520234..1520482) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995800.1 CDS complement(1520498..1521253) product SDR family oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_13950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678232.1 CDS 1521395..1522210 product Pyrroline-5-carboxylate reductase transl_table 11 codon_start 1 locus_tag LOCUS_13960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779749.1 CDS complement(1522315..1523235) product ribonuclease Z transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rnz inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454063.1 CDS complement(1523292..1523426) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1523548..1525032 product glucose-6-phosphate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene zwf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105070.1 CDS 1525262..1526128 product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571108.1 CDS complement(1526211..1527860) product alpha-glucosidase transl_table 11 codon_start 1 locus_tag LOCUS_14010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041915.1 CDS complement(1527876..1528895) product LacI family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene malR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256319.1 CDS complement(1529089..1529460) product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_14030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413436.1 CDS complement(1529679..1531085) product phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating) transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene gnd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193707.1 CDS complement(1531153..1532286) product Peptidase T, putative transl_table 11 codon_start 1 locus_tag LOCUS_14050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606693.1 CDS 1532549..1532728 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789875.1 CDS complement(1532855..1533835) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_14070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916196.1 CDS complement(1533849..1534286) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene brxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367419.1 CDS complement(1534637..1535911) product 2-oxoglutarate dehydrogenase E2 transl_table 11 codon_start 1 locus_tag LOCUS_14090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406838.1 CDS complement(1535924..1536907) product alpha-ketoacid dehydrogenase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_14100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096633.1 CDS complement(1536907..1537899) product 2-oxoisovalerate dehydrogenase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_14110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568351.1 CDS complement(1537915..1539336) product dihydrolipoyl dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene lpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291533.1 CDS complement(1539487..1541166) product DNA repair protein RecN transl_table 11 codon_start 1 locus_tag LOCUS_14130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942210.1 CDS complement(1541182..1541634) product arginine repressor transl_table 11 codon_start 1 locus_tag LOCUS_14140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124985.1 CDS complement(1542066..1542947) product geranyltranstransferase transl_table 11 codon_start 1 locus_tag LOCUS_14150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183383.1 CDS complement(1542925..1543155) product exodeoxyribonuclease 7 small subunit transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene xseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159865.1 CDS complement(1543148..1544485) product exodeoxyribonuclease 7 large subunit transl_table 11 codon_start 1 locus_tag LOCUS_14170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286928.1 CDS complement(1544502..1544891) product N utilization substance protein B transl_table 11 codon_start 1 locus_tag LOCUS_14180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087385.1 CDS complement(1544951..1545313) product Asp23/Gls24 family envelope stress response protein transl_table 11 codon_start 1 locus_tag LOCUS_14190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241588.1 CDS complement(1545328..1546683) product acetyl-CoA carboxylase biotin carboxylase subunit transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene accC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756612.1 CDS complement(1546683..1547147) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene accB_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 CDS complement(1547621..1548178) product elongation factor P transl_table 11 codon_start 1 locus_tag LOCUS_14220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626504.1 CDS complement(1548204..1549265) product peptidase M24 family protein transl_table 11 codon_start 1 locus_tag LOCUS_14230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 CDS 1549370..1549951 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737686.1 CDS 1549965..1550183 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_14250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244298.1 CDS complement(1550247..1551077) product octanoyltransferase LipM transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene lipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 CDS 1551235..1551621 product rhodanese transl_table 11 codon_start 1 locus_tag LOCUS_14270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276571.1 CDS complement(1551986..1553458) product Probable glycine dehydrogenase (decarboxylating) subunit 2 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene gcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202188.1 CDS complement(1553451..1554797) product glycine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene gcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019691.1 CDS complement(1554817..1555908) product aminomethyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene gcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093349.1 CDS complement(1556067..1556591) product shikimate kinase transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene aroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015120.1 CDS complement(1556824..1557201) product Competence protein ComGF transl_table 11 codon_start 1 locus_tag LOCUS_14320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788897.1 CDS complement(1557239..1557538) product Late competence protein ComGE transl_table 11 codon_start 1 locus_tag LOCUS_14330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072398116.1 CDS complement(1557525..1557908) product Competence ComGD-like protein transl_table 11 codon_start 1 locus_tag LOCUS_14340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788899.1 CDS complement(1557949..1558260) product competence protein ComGC transl_table 11 codon_start 1 locus_tag LOCUS_14350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472256.1 CDS complement(1558274..1559194) product Putative competence protein ComGB transl_table 11 codon_start 1 locus_tag LOCUS_14360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776422.1 CDS complement(1559316..1560290) product type II/IV secretion system protein transl_table 11 codon_start 1 locus_tag LOCUS_14370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697220.1 CDS complement(1560342..1560965) product MBL fold metallo-hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_14380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223008.1 CDS complement(1560962..1561291) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018871.1 CDS complement(1561291..1562277) product glucokinase transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene glk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161311.1 CDS complement(1562274..1562477) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087561.1 CDS complement(1562458..1562874) product Membrane peptidase, contains TPR repeat domain transl_table 11 codon_start 1 locus_tag LOCUS_14420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(1562911..1563921) product rhomboid family intramembrane serine protease transl_table 11 codon_start 1 locus_tag LOCUS_14430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(1563933..1564526) product 5-formyltetrahydrofolate cyclo-ligase transl_table 11 codon_start 1 locus_tag LOCUS_14440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164546.1 CDS complement(1564681..1564830) product 50S ribosomal protein L33 transl_table 11 codon_start 1 locus_tag LOCUS_14450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265709.1 CDS complement(1564943..1567018) product penicillin-binding protein 3 transl_table 11 codon_start 1 locus_tag LOCUS_14460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919769.1 CDS complement(1567139..1567738) product superoxide dismutase transl_table 11 codon_start 1 locus_tag LOCUS_14470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863556.1 CDS complement(1568014..1568424) product transcriptional repressor transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene fur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 CDS complement(1568411..1569274) product metal ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_14490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564315.1 CDS complement(1569316..1570083) product zinc ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_14500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 CDS complement(1570227..1571117) product endonuclease transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene nfo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 CDS complement(1571127..1572473) product DEAD/DEAH box family ATP-dependent RNA helicase transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene cshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062176.1 CDS complement(1572587..1573687) product Nif3-like dinuclear metal center hexameric protein transl_table 11 codon_start 1 locus_tag LOCUS_14530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683940.1 CDS complement(1573690..1574367) product tRNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624577.1 CDS complement(1574498..1575604) product RNA polymerase sigma factor SigA transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene rpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283055.1 CDS complement(1575828..1577627) product DNA primase transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene dnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217257.1 CDS complement(1577688..1578506) product phosphoenolpyruvate synthetase regulatory protein transl_table 11 codon_start 1 locus_tag LOCUS_14570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411298.1 CDS complement(1578517..1579056) product CBS domain pair protein transl_table 11 codon_start 1 locus_tag LOCUS_14580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797828.1 CDS 1579475..1580866 product glycine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_14590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030080.1 CDS complement(1581016..1581768) product DNA repair protein RecO transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene recO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557361.1 CDS complement(1581790..1582689) product GTPase Era transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 CDS complement(1582690..1583094) product cytidine deaminase transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene cdd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121875.1 CDS complement(1583105..1583449) product diacylglycerol kinase transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene dgkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 CDS complement(1583452..1583919) product endoribonuclease YbeY transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene ybeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 CDS complement(1583920..1584867) product PhoH family protein transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene phoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 CDS complement(1585171..1585869) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110600.1 CDS complement(1585886..1586875) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492108.1 CDS complement(1586893..1587600) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_14680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802667.1 CDS complement(1587820..1587996) product 30S ribosomal protein S21 transl_table 11 codon_start 1 locus_tag LOCUS_14690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1588289..1589635) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene yqeV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108668.1 CDS complement(1589642..1590403) product 16S rRNA (uracil(1498)-N(3))-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 CDS complement(1590396..1591334) product 50S ribosomal protein L11 methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene prmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104607.1 CDS complement(1591338..1592477) product molecular chaperone DnaJ transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene dnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119021.1 CDS complement(1592613..1594445) product molecular chaperone DnaK transl_table 11 codon_start 1 locus_tag LOCUS_14740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034716.1 CDS complement(1594514..1595140) product nucleotide exchange factor GrpE transl_table 11 codon_start 1 locus_tag LOCUS_14750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182211.1 CDS complement(1595172..1596149) product HrcA family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene hrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627144.1 CDS complement(1596250..1597374) product Heme chaperone HemW transl_table 11 codon_start 1 locus_tag LOCUS_14770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218103.1 CDS complement(1597937..1599760) product elongation factor 4 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene lepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368338.1 CDS 1600106..1600357 product 30S ribosomal protein S20 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rpsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274017.1 CDS complement(1600402..1601376) product DNA polymerase III subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene holA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 CDS complement(1601433..1603613) product ComEC family competence protein transl_table 11 codon_start 1 locus_tag LOCUS_14810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953309.1 CDS complement(1603639..1604100) product ComE operon protein 2 transl_table 11 codon_start 1 locus_tag LOCUS_14820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 CDS complement(1604192..1604869) product competence protein ComE transl_table 11 codon_start 1 locus_tag LOCUS_14830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802022.1 CDS complement(1604918..1605634) product SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084830.1 CDS complement(1605637..1605990) product ribosome silencing factor RsfS transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene rsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088020.1 CDS complement(1605991..1606575) product haloacid dehalogenase transl_table 11 codon_start 1 locus_tag LOCUS_14860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019324.1 CDS complement(1606565..1607134) product nicotinate-nicotinamide nucleotide adenylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene nadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725167.1 CDS complement(1607137..1607427) product RNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_14880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 CDS complement(1607431..1608237) product shikimate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene aroE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666757.1 CDS complement(1608251..1609351) product ribosome biogenesis GTPase YqeH transl_table 11 codon_start 1 locus_tag LOCUS_14900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280137.1 CDS complement(1609352..1609879) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524903.1 CDS complement(1609899..1610585) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene mtnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579275.1 CDS 1610899..1611168 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829749.1 CDS complement(1611370..1612122) product enterotoxin transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene entA inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1612536..1613756) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 CDS complement(1614045..1615274) product divalent metal cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_14960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533238.1 CDS complement(1615287..1616039) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene pxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261793.1 CDS complement(1616039..1617400) product acetyl-CoA carboxylase biotin carboxylase subunit transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene accC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942744.1 CDS complement(1617414..1617863) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene accB_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019340.1 CDS complement(1617865..1618875) product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_15000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023319.1 CDS complement(1618865..1619599) product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_15010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383180.1 CDS complement(1619925..1620401) product transcription elongation factor GreA transl_table 11 codon_start 1 locus_tag LOCUS_15020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 CDS complement(1620429..1621052) product uridine kinase transl_table 11 codon_start 1 locus_tag LOCUS_15030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 CDS complement(1621052..1622320) product collagenase-like protease transl_table 11 codon_start 1 locus_tag LOCUS_15040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848304.1 CDS complement(1622332..1623255) product peptidase U32 transl_table 11 codon_start 1 locus_tag LOCUS_15050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137774.1 CDS complement(1623258..1623896) product O-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene trmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342258.1 CDS complement(1624181..1624489) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134779.1 CDS complement(1624504..1624932) product Holliday junction resolvase RuvX transl_table 11 codon_start 1 locus_tag LOCUS_15080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939059.1 CDS complement(1624936..1625196) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426912.1 CDS complement(1625259..1627889) product alanine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene alaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734075.1 CDS complement(1628232..1630709) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283312.1 CDS complement(1630711..1631379) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567017.1 CDS complement(1631841..1632614) product tRNA 2-thiouridine(34) synthase MnmA transl_table 11 codon_start 1 locus_tag LOCUS_15130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1632625 CDS complement(1632623..1632958) product tRNA-uridine 2-sulfurtransferase (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_15140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1632625 CDS complement(1632959..1634101) product cysteine desulfurase transl_table 11 codon_start 1 locus_tag LOCUS_15150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409157.1 CDS 1634413..1635426 product Bac_luciferase domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_15160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985878.1 CDS complement(1635663..1635809) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1635849..1636031) product CsbD-like protein transl_table 11 codon_start 1 locus_tag LOCUS_15180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752909.1 CDS complement(1636204..1636554) product Rrf2 family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_15190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1636251 CDS 1636639..1637913 product recombinase RarA transl_table 11 codon_start 1 locus_tag LOCUS_15200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102729.1 CDS complement(1638074..1638847) product tRNA threonylcarbamoyladenosine dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_15210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682646.1 CDS complement(1639308..1641074) product Aspartate--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene aspS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044799.1 CDS complement(1641090..1642352) product histidine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_15230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 CDS complement(1642813..1643688) product cell wall amidase transl_table 11 codon_start 1 locus_tag LOCUS_15240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717800.1 CDS complement(1643685..1644137) product D-tyrosyl-tRNA(Tyr) deacylase transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene dtd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869983.1 CDS complement(1644149..1646338) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_15260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058587.1 CDS complement(1646766..1647284) product adenine phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364542.1 CDS complement(1647306..1649579) product single-stranded-DNA-specific exonuclease RecJ transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene recJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595011.1 CDS complement(1649782..1652061) product protein translocase subunit SecDF transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene secF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749795.1 CDS complement(1652336..1652596) product preprotein translocase subunit YajC transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene yajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160682.1 CDS complement(1652615..1653754) product tRNA guanosine(34) transglycosylase Tgt transl_table 11 codon_start 1 locus_tag LOCUS_15310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 CDS complement(1653777..1654802) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene queA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019178.1 CDS complement(1654804..1655808) product Holliday junction branch migration DNA helicase RuvB transl_table 11 codon_start 1 locus_tag LOCUS_15330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005768.1 CDS complement(1655840..1656442) product Holliday junction branch migration protein RuvA transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene ruvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271550.1 CDS complement(1656456..1656911) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368902.1 CDS complement(1656924..1658216) product GTPase ObgE transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene cgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496100.1 CDS complement(1658571..1658855) product 50S ribosomal protein L27 transl_table 11 codon_start 1 locus_tag LOCUS_15370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 CDS complement(1658867..1659187) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633692.1 CDS complement(1659193..1659501) product 50S ribosomal protein L21 transl_table 11 codon_start 1 locus_tag LOCUS_15390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 CDS complement(1659668..1660198) product rod shape-determining protein MreD transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene mreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259925.1 CDS complement(1660198..1661040) product rod shape-determining protein MreC transl_table 11 codon_start 1 locus_tag LOCUS_15410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911041.1 CDS complement(1661433..1661906) product DUF4930 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_15420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236734.1 CDS 1662066..1662263 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025835.1 CDS complement(1662380..1662664) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171859.1 CDS complement(1662732..1663418) product DNA repair RadC family protein transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene radC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445860.1 CDS complement(1663415..1663978) product Prepilin peptidase transl_table 11 codon_start 1 locus_tag LOCUS_15460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261115.1 CDS complement(1664392..1665663) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene folC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108346.1 CDS complement(1665676..1668306) product valine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene valS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 CDS 1668709..1669269 product DNA-3-methyladenine glycosylase I transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene tag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001237.1 CDS complement(1669492..1670565) product aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_15500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177998.1 CDS complement(1670761..1672047) product glutamate-1-semialdehyde 2,1-aminomutase transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene hemL_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270865.1 CDS complement(1672095..1673069) product delta-aminolevulinic acid dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene hemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667126.1 CDS complement(1673072..1673740) product uroporphyrinogen III methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene hemD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805951.1 CDS complement(1673762..1674688) product hydroxymethylbilane synthase transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene hemC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230232.1 CDS complement(1674730..1675545) product cytochrome c assembly protein transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene hemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157329.1 CDS complement(1675567..1676913) product Glutamyl-tRNA reductase transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene hemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545451.1 CDS complement(1677130..1677720) product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_15570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867697.1 CDS complement(1677874..1679136) product ATP-dependent Clp protease ATP-binding subunit ClpX transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene clpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472302.1 CDS complement(1679287..1680588) product Trigger factor transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene tig inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 CDS complement(1680751..1681680) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280022.1 CDS complement(1681699..1682307) product DNA mismatch repair protein MutT transl_table 11 codon_start 1 locus_tag LOCUS_15610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032657.1 CDS complement(1682449..1682805) product 50S ribosomal protein L20 transl_table 11 codon_start 1 locus_tag LOCUS_15620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 CDS complement(1682852..1683052) product 50S ribosomal protein L35 transl_table 11 codon_start 1 locus_tag LOCUS_15630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125540.1 CDS complement(1683081..1683608) product Translation initiation factor IF-3 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene infC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791162.1 CDS complement(1683837..1685330) product gamma-aminobutyrate permease transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene lysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049145.1 CDS complement(1685756..1687693) product Threonine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene thrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 CDS complement(1688106..1689026) product primosomal protein DnaI transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene dnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808621.1 CDS complement(1689026..1690426) product helicase DnaB transl_table 11 codon_start 1 locus_tag LOCUS_15680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533479.1 CDS complement(1690427..1690897) product transcriptional regulator NrdR transl_table 11 codon_start 1 locus_tag LOCUS_15690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650082.1 CDS complement(1691107..1692132) product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene gap_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106141.1 CDS complement(1692302..1692925) product Dephospho-CoA kinase transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene coaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127167.1 CDS complement(1692941..1693813) product DNA-formamidopyrimidine glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene mutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114454.1 CDS complement(1693829..1696459) product DNA polymerase I transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene polA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 CDS complement(1696753..1698240) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849428.1 CDS complement(1698739..1700379) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene phoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445861.1 CDS complement(1700400..1701104) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene phoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080028.1 CDS complement(1701494..1702762) product isocitrate dehydrogenase (NADP(+)) transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene icd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123165.1 CDS complement(1702811..1703857) product citrate synthase transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene gltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829167.1 CDS 1704280..1705641 product alanine glycine permease transl_table 11 codon_start 1 locus_tag LOCUS_15790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818525.1 CDS complement(1705674..1706480) product Transposase, putative transl_table 11 codon_start 1 locus_tag LOCUS_15800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1705705,1706524 note possible pseudo due to internal stop codon CDS complement(1706498..1707325) product Truncated transposase, putative transl_table 11 codon_start 1 locus_tag LOCUS_15810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1706524 note possible pseudo due to internal stop codon CDS complement(1707966..1709723) product pyruvate kinase transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene pyk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232648.1 CDS complement(1709745..1710713) product ATP-dependent 6-phosphofructokinase transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene pfkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717561.1 CDS complement(1710982..1711926) product acetyl-CoA carboxylase carboxyl transferase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene accA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883648.1 CDS complement(1711926..1712783) product Acetyl-CoA carboxylase transl_table 11 codon_start 1 locus_tag LOCUS_15850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471571.1 CDS complement(1712978..1714207) product NAD-dependent malic enzyme 4 transl_table 11 codon_start 1 locus_tag LOCUS_15860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058389.1 CDS complement(1714657..1717854) product DNA polymerase III subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene dnaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226919.1 CDS complement(1717875..1718816) product bifunctional oligoribonuclease/PAP phosphatase NrnA transl_table 11 codon_start 1 locus_tag LOCUS_15880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626082.1 CDS complement(1719077..1720375) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160435.1 CDS 1720580..1720993 product universal stress protein transl_table 11 codon_start 1 locus_tag LOCUS_15900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277602.1 CDS complement(1721298..1721987) product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_15910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777188.1 CDS 1722162..1723217 product dipeptidase transl_table 11 codon_start 1 locus_tag LOCUS_15920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161666.1 CDS complement(1723533..1724651) product alanine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene ald inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690007.1 CDS 1724792..1725292 product universal stress protein UspA transl_table 11 codon_start 1 locus_tag LOCUS_15940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 CDS complement(1725538..1726740) product acetate kinase transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene ackA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040063.1 CDS complement(1726828..1727775) product class I SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840576.1 CDS complement(1727898..1728392) product 2-Cys peroxiredoxin transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene tpx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136260.1 CDS complement(1728490..1729260) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_15980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365312.1 CDS complement(1729304..1730527) product tRNA 4-thiouridine(8) synthase ThiI transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene thiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872662.1 CDS complement(1730527..1731666) product Aminotran_5 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840521.1 CDS complement(1732038..1733732) product Septation ring formation regulator EzrA transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene ezrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244866.1 CDS 1733869..1734333 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207852.1 CDS 1734577..1735179 product 30S ribosomal protein S4 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene rpsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090512.1 CDS complement(1735395..1736138) product glycerophosphoryl diester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_16040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174284.1 CDS 1736218..1736664 product peroxiredoxin transl_table 11 codon_start 1 locus_tag LOCUS_16050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553924.1 CDS 1736778..1737938 product alanine--glyoxylate aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_16060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291420.1 CDS 1737925..1739529 product D-3-phosphoglycerate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene serA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808849.1 CDS complement(1739679..1740809) product Hydrolase, haloacid dehalogenase-like family protein transl_table 11 codon_start 1 locus_tag LOCUS_16080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721699.1 CDS complement(1740916..1742382) product PTS glucose transporter subunit IIBC transl_table 11 codon_start 1 locus_tag LOCUS_16090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276367.1 CDS complement(1742510..1743127) product 1-acyl-sn-glycerol-3-phosphate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_16100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287588.1 CDS 1743299..1744573 product serine protease transl_table 11 codon_start 1 locus_tag LOCUS_16110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279338.1 CDS complement(1744667..1745929) product tyrosine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_16120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 CDS 1746311..1747216 product transglycosylase transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene sgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184370.1 CDS complement(1747419..1750106) product Haptoglobin receptor A transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene isdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032804.1 CDS complement(1750440..1752107) product Formate--tetrahydrofolate ligase transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene fhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 CDS complement(1752547..1754253) product acetate--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene acsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 CDS 1754422..1755054 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene acuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016004.1 CDS 1755079..1756248 product acetoin utilization protein AcuC transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene acuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184011.1 CDS complement(1756346..1757335) product catabolite control protein A transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene ccpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219066.1 CDS complement(1757875..1758966) product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase transl_table 11 codon_start 1 locus_tag LOCUS_16200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066378.1 CDS complement(1759666..1761183) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193903.1 CDS complement(1761257..1761748) product DUF948 domain containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383814.1 CDS complement(1761822..1763135) product UDP-N-acetylmuramate--L-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene murC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150169.1 CDS complement(1763159..1766983) product DNA translocase FtsK transl_table 11 codon_start 1 locus_tag LOCUS_16240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118314.1 CDS complement(1767004..1767600) product tRNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_16250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048368.1 CDS complement(1767629..1768486) product DUF1444 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091387.1 CDS complement(1768586..1768897) product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_16270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811163.1 CDS complement(1768962..1770038) product glutamyl aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_16280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024576.1 CDS 1770125..1770436 product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_16290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163826.1 CDS complement(1770561..1771445) product Metallo-beta-lactamase transl_table 11 codon_start 1 locus_tag LOCUS_16300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689582.1 CDS complement(1771873..1772517) product tRNA (guanine-N(7)-)-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene trmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266161.1 CDS complement(1772532..1773323) product phosphotransferase transl_table 11 codon_start 1 locus_tag LOCUS_16320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434765.1 CDS complement(1773873..1774721) product D-alanine aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene dat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411084.1 CDS complement(1774725..1776134) product dipeptidase PepV transl_table 11 codon_start 1 locus_tag LOCUS_16340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265417.1 repeat_region 1776486..1776694 rpt_family CRISPR rpt_type direct rpt_unit_seq ataatgtgcaagttggggtaagggccccaacacaga inference COORDINATES:alignment:CRT:1.2 CDS complement(1776998..1777420) product YtxH domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051856.1 CDS complement(1777437..1778132) product 16S rRNA pseudouridine(516) synthase transl_table 11 codon_start 1 locus_tag LOCUS_16360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217125.1 CDS complement(1778129..1779790) product polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_16370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004335.1 CDS 1780197..1781465 product aminoacetone oxidase family FAD-binding enzyme transl_table 11 codon_start 1 locus_tag LOCUS_16380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285020.1 CDS complement(1781582..1788142) product DUF1542 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050566.1 CDS complement(1788485..1788796) product rhodanese-like domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836461.1 CDS complement(1788818..1791232) product leucine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene leuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 CDS complement(1791523..1792704) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_16420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025067.1 CDS 1792814..1793767 product TIGR01212 family radical SAM protein transl_table 11 codon_start 1 locus_tag LOCUS_16430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526539.1 CDS 1793764..1794327 product rRNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_16440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764419.1 CDS complement(1794447..1794848) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757543.1 CDS complement(1795368..1795592) product Mobile element protein transl_table 11 codon_start 1 locus_tag LOCUS_16460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1795615 CDS complement(1795589..1796080) product IS5/IS1182 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_16470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1796056,1796028,1795614 CDS complement(1796427..1797254) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_16480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266096.1 CDS 1797488..1798489 product proline dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene putA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196362.1 CDS complement(1798611..1799075) product 6,7-dimethyl-8-ribityllumazine synthase transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene ribH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008549.1 CDS complement(1799088..1800269) product riboflavin biosynthesis protein RibBA transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene ribBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159037.1 CDS complement(1800280..1800912) product riboflavin synthase transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene ribE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493887.1 CDS complement(1800919..1801962) product Riboflavin biosynthesis protein RibD transl_table 11 codon_start 1 locus_tag LOCUS_16530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384185.1 CDS complement(1802443..1803945) product NAD_binding_9 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261668.1 CDS complement(1803968..1804087) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1804468..1804782 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221177.1 CDS 1804782..1806074 product Arsenical pump membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_16570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989121.1 CDS 1806092..1806487 product protein ArsC transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene arsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358995.1 CDS complement(1806782..1807636) product autolysin transl_table 11 codon_start 1 locus_tag LOCUS_16590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032833.1 CDS complement(1807912..1808136) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384171.1 CDS 1808335..1808805 product RNA polymerase sigma factor SigS transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene sigS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671057.1 CDS 1808918..1809361 product competence protein ComK transl_table 11 codon_start 1 locus_tag LOCUS_16620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153742.1 CDS complement(1809348..1809791) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030469.1 CDS 1810087..1810722 product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_16640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168903.1 CDS complement(1811162..1811875) product transaldolase transl_table 11 codon_start 1 locus_tag LOCUS_16650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096495.1 CDS 1812135..1812437 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091442.1 CDS 1812693..1813058 product camphor resistance protein CrcB transl_table 11 codon_start 1 locus_tag LOCUS_16670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200542.1 CDS 1813055..1813408 product camphor resistance protein CrcB transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene crcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623470.1 CDS 1813964..1814788 product Truncated transposase, putative transl_table 11 codon_start 1 locus_tag LOCUS_16690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1814785 CDS 1814821..1815429 product Truncated transposase, putative transl_table 11 codon_start 1 locus_tag LOCUS_16700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1814785,1815397 CDS complement(1815492..1816325) product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_16710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453306.1 CDS complement(1816537..1817445) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366163.1 CDS complement(1817570..1818763) product S-adenosylmethionine synthase transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene metK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 CDS 1819134..1820726 product phosphoenolpyruvate carboxykinase (ATP) transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene pckA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 CDS complement(1820862..1821347) product IS200/IS605 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_16750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829489.1 note frameshifted, insertion/deletion at around 1821424,1821417 CDS complement(1821722..1822492) product Peptidase_S9 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822900.1 CDS complement(1822473..1822946) product nucleoside triphosphatase YtkD transl_table 11 codon_start 1 locus_tag LOCUS_16770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672013.1 CDS 1823012..1823269 product membrane protein insertion efficiency factor YidD transl_table 11 codon_start 1 locus_tag LOCUS_16780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718107.1 CDS complement(1823266..1824267) product o-succinylbenzoate synthase transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene menC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778528.1 CDS complement(1824272..1825750) product 2-succinylbenzoate-CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene menE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348364.1 CDS complement(1825909..1826391) product Putative lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_16810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840523.1 CDS 1826703..1827317 product calcium-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_16820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795210.1 CDS 1827398..1828393 product DUF4352 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070642.1 CDS 1828469..1829095 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669024.1 CDS 1829136..1829480 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627540.1 CDS 1829578..1830129 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414216.1 CDS complement(1830347..1830988) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1831102..1831287) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1831289..1831465) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1831476..1831859) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1832051..1832260) product transposase transl_table 11 codon_start 1 locus_tag LOCUS_16910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1832463..1832606) product transposase transl_table 11 codon_start 1 locus_tag LOCUS_16920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 1832453 note possible pseudo due to internal stop codon CDS complement(1833476..1833853) product Exported protein transl_table 11 codon_start 1 locus_tag LOCUS_16930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1834373..1838485) product NTPase transl_table 11 codon_start 1 locus_tag LOCUS_16940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1839335..1840534) product Type I restriction-modification enzyme, S subunit, EcoA family, putative transl_table 11 codon_start 1 locus_tag LOCUS_16950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072627.1 CDS complement(1840527..1842083) product Site-specific DNA-methyltransferase (adenine-specific) transl_table 11 codon_start 1 locus_tag LOCUS_16960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793440.1 CDS complement(1842446..1843165) product serine protease SplF transl_table 11 codon_start 1 locus_tag LOCUS_16970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038752.1 CDS complement(1843316..1844032) product serine protease SplE transl_table 11 codon_start 1 locus_tag LOCUS_16980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038752.1 CDS complement(1844190..1844909) product serine protease SplD transl_table 11 codon_start 1 locus_tag LOCUS_16990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038704.1 CDS complement(1845030..1845749) product serine protease SplC transl_table 11 codon_start 1 locus_tag LOCUS_17000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038872.1 CDS complement(1845807..1846529) product serine protease SplB transl_table 11 codon_start 1 locus_tag LOCUS_17010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039454.1 CDS complement(1846654..1847361) product Serine protease transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene splA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039427.1 CDS 1848325..1848891 product MW1757 protein transl_table 11 codon_start 1 locus_tag LOCUS_17030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092780.1 CDS complement(1849365..1850063) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene epiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1850115..1850459 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene epiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1850818..1851510) product bacitracin ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene epiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254089.1 CDS complement(1851533..1852906) product peptidase S8 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene epiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1852916..1853434) product enterotoxin transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene epiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1853450..1854694) product lanthionine synthetase transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene epiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1854687..1857680) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene epiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 CDS complement(1857745..1857888) product lantibiotic epidermin transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene epiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1858625..1858768) product lantibiotic epidermin transl_table 11 codon_start 1 locus_tag LOCUS_17120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1859010..1859993) product leucotoxin LukDv transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene lukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782463.1 CDS complement(1859995..1860915) product gamma-hemolysin subunit A transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene lukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473596.1 CDS 1861759..1862268 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1862281..1863069 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206343.1 tRNA complement(1864312..1864400) product hypothetical protein locus_tag LOCUS_t00160 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864454..1864527) product Ribosome maturation factor RimM (Fragment) locus_tag LOCUS_t00170 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864528..1864602) product tRNA-Asn locus_tag LOCUS_t00180 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864617..1864690) product tRNA-Gly locus_tag LOCUS_t00190 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864706..1864781) product tRNA-His locus_tag LOCUS_t00200 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864795..1864867) product tRNA-Phe locus_tag LOCUS_t00210 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864884..1864959) product tRNA-Met locus_tag LOCUS_t00220 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1864981..1865054) product tRNA-Met locus_tag LOCUS_t00230 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(1865526..1866080) product Hydrolase YdeN transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene ydeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132890.1 CDS complement(1866403..1867803) product Coproporphyrinogen III oxidase transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene hemG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167542.1 CDS complement(1867827..1868750) product Coproporphyrin III ferrochelatase transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene hemH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162881.1 CDS complement(1868808..1869842) product uroporphyrinogen decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene hemE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233526.1 CDS 1870108..1870611 product signal transduction protein TRAP transl_table 11 codon_start 1 locus_tag LOCUS_17210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737976.1 CDS complement(1870735..1871958) product multidrug ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551836.1 CDS complement(1871951..1872691) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216874.1 CDS 1872825..1873247 product HIT family protein transl_table 11 codon_start 1 locus_tag LOCUS_17240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 CDS 1873389..1873754 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648118.1 CDS 1874487..1875044 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477959.1 CDS 1875249..1876211 product foldase transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene prsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782121.1 CDS complement(1876332..1877273) product 3'-5' exoribonuclease YhaM transl_table 11 codon_start 1 locus_tag LOCUS_17280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244175.1 CDS complement(1877270..1880206) product AAA_27 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584628.1 CDS complement(1880196..1881392) product DNA repair exonuclease transl_table 11 codon_start 1 locus_tag LOCUS_17300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238227.1 CDS complement(1882164..1882508) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290301.1 CDS complement(1882577..1883701) product DUF445 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992518.1 CDS complement(1883880..1884344) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_17330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375864.1 CDS complement(1884700..1885323) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_17340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 CDS complement(1885345..1886457) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_17350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437969.1 CDS 1886620..1887441 product RNA pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_17360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669376.1 CDS complement(1887904..1889289) product class II fumarate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene fumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116228.1 CDS complement(1889485..1889880) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901023.1 CDS complement(1890657..1890809) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031108.1 CDS complement(1890834..1891433) product glucosamine-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_17400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251224.1 CDS complement(1891592..1892062) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL transl_table 11 codon_start 1 locus_tag LOCUS_17410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181394.1 CDS complement(1892067..1893194) product epoxyqueuosine reductase transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene queG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793998.1 CDS complement(1893345..1894073) product amino acid ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 CDS complement(1894060..1895517) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_17440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 CDS complement(1895775..1896836) product PTS transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_17450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063580.1 CDS 1897329..1898531 product ISL3 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene tnp_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557163.1 tRNA complement(1898905..1898988) product tRNA-Leu locus_tag LOCUS_t00240 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899027..1899101) product tRNA-Gly locus_tag LOCUS_t00250 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899115..1899189) product tRNA-Gly locus_tag LOCUS_t00260 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899205..1899279) product tRNA-Gly locus_tag LOCUS_t00270 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899287..1899360) product tRNA-Cys locus_tag LOCUS_t00280 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899366..1899437) product tRNA-Gln locus_tag LOCUS_t00290 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899448..1899521) product tRNA-His locus_tag LOCUS_t00300 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899524..1899597) product tRNA-Trp locus_tag LOCUS_t00310 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899612..1899694) product hypothetical protein locus_tag LOCUS_t00320 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899699..1899774) product 5S ribosomal RNA locus_tag LOCUS_t00330 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899781..1899855) product tRNA-Phe locus_tag LOCUS_t00340 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899873..1899948) product tRNA-Met locus_tag LOCUS_t00350 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1899957..1900032) product tRNA-Met locus_tag LOCUS_t00360 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900046..1900138) product tRNA-Ser locus_tag LOCUS_t00370 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900177..1900252) product tRNA-Met locus_tag LOCUS_t00380 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900262..1900353) product tRNA-Ser locus_tag LOCUS_t00390 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900362..1900435) product tRNA-Met locus_tag LOCUS_t00400 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900463..1900537) product tRNA-Arg locus_tag LOCUS_t00410 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900559..1900634) product tRNA-Val locus_tag LOCUS_t00420 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900652..1900725) product tRNA-Pro locus_tag LOCUS_t00430 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900734..1900809) product tRNA-Pro locus_tag LOCUS_t00440 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900827..1900915) product tRNA-Leu locus_tag LOCUS_t00450 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1900926..1901000) product tRNA-Gly locus_tag LOCUS_t00460 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1901003..1901086) product tRNA-Leu locus_tag LOCUS_t00470 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1901089..1901164) product tRNA-Lys locus_tag LOCUS_t00480 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1901170..1901245) product 5S ribosomal RNA locus_tag LOCUS_t00490 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1901262..1901337) product tRNA-Val locus_tag LOCUS_t00500 inference COORDINATES:profile:Aragorn:1.2.38 rRNA complement(1901384..1901461) product tRNA-Lys locus_tag LOCUS_r00080 inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA rRNA complement(1901538..1904455) product 23S ribosomal RNA locus_tag LOCUS_r00090 inference COORDINATES:profile:Barrnap:0.8 tRNA complement(1904671..1904746) product tRNA-Val locus_tag LOCUS_t00510 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(1904765..1904841) product tRNA-Ile locus_tag LOCUS_t00520 inference COORDINATES:profile:Aragorn:1.2.38 rRNA complement(1904934..1906482) product 16S ribosomal RNA locus_tag LOCUS_r00100 inference COORDINATES:profile:Barrnap:0.8 CDS complement(1907224..1907670) product transcriptional repressor transl_table 11 codon_start 1 locus_tag LOCUS_17470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110007.1 CDS complement(1907767..1908717) product 2-hydroxyacid dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_17480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869446.1 CDS complement(1908723..1909178) product NADH-dependent peroxiredoxin transl_table 11 codon_start 1 locus_tag LOCUS_17490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939521.1 CDS 1909259..1910548 product glutamate-1-semialdehyde 2,1-aminomutase transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene hemL_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011595.1 CDS 1910841..1911935 product aromatic acid exporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_17510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236371.1 CDS complement(1912126..1913862) product multidrug ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 CDS complement(1914153..1914695) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251253.1 CDS complement(1914997..1916034) product A/G-specific adenine glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene mutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284765.1 CDS 1916186..1917163 product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_17550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379098.1 CDS 1917267..1917497 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792192.1 CDS complement(1917424..1918260) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_17570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886462.1 CDS complement(1918269..1919786) product teichoic acid ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535834.1 CDS complement(1919801..1920115) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435806.1 CDS complement(1920093..1920911) product regulatory protein RecX transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene recX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124422.1 CDS complement(1921172..1921981) product monofunctional glycosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_17610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830380.1 CDS complement(1922322..1922837) product glutamine amidotransferase transl_table 11 codon_start 1 locus_tag LOCUS_17620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 CDS complement(1922968..1923129) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005407.1 CDS complement(1923883..1924068) product ORF073 transl_table 11 codon_start 1 locus_tag LOCUS_17640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382163.1 CDS complement(1924251..1924379) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_17650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788502.1 CDS complement(1924647..1926092) product Amidase transl_table 11 codon_start 1 locus_tag LOCUS_17660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148136.1 CDS complement(1926073..1926510) product Holin transl_table 11 codon_start 1 locus_tag LOCUS_17670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354127.1 CDS complement(1926566..1926961) product Phi ETA orf 63-like protein transl_table 11 codon_start 1 locus_tag LOCUS_17680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398870.1 CDS complement(1926967..1928139) product Phage tail fiber protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_17690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276646.1 CDS complement(1928152..1930050) product Bifunctional autolysin transl_table 11 codon_start 1 locus_tag LOCUS_17700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524006.1 CDS complement(1930187..1930486) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466784.1 CDS complement(1930526..1930699) product XkdX family protein transl_table 11 codon_start 1 locus_tag LOCUS_17720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782200.1 CDS complement(1930703..1931080) product ORF036 transl_table 11 codon_start 1 locus_tag LOCUS_17730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705911.1 CDS complement(1931080..1932903) product PhiETA ORF57-like protein transl_table 11 codon_start 1 locus_tag LOCUS_17740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259629.1 CDS complement(1932903..1934813) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369014.1 CDS complement(1934828..1936729) product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_17760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156404.1 CDS complement(1936738..1937685) product phage tail family protein transl_table 11 codon_start 1 locus_tag LOCUS_17770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350686.1 CDS complement(1937698..1941165) product Phage tape measure protein transl_table 11 codon_start 1 locus_tag LOCUS_17780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141453.1 CDS complement(1941182..1941526) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105584.1 CDS complement(1941556..1941921) product Tail assembly chaperone protein transl_table 11 codon_start 1 locus_tag LOCUS_17800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100167.1 CDS complement(1941983..1942564) product Phage structural protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_17810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002577.1 CDS complement(1942583..1942966) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_17820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188649.1 CDS complement(1942978..1943325) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017814.1 CDS complement(1943325..1943627) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_17840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268314.1 CDS complement(1943624..1943956) product phage head-tail adapter protein transl_table 11 codon_start 1 locus_tag LOCUS_17850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208960.1 CDS complement(1943965..1944252) product Phi Mu50B-like protein transl_table 11 codon_start 1 locus_tag LOCUS_17860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114085.1 CDS complement(1944274..1945248) product Phage head protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_17870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 CDS complement(1945262..1945882) product ORF022 transl_table 11 codon_start 1 locus_tag LOCUS_17880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354307.1 CDS complement(1945991..1946161) product ORF094 transl_table 11 codon_start 1 locus_tag LOCUS_17890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072207.1 CDS complement(1946234..1947229) product ORF014 transl_table 11 codon_start 1 locus_tag LOCUS_17900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133043.1 CDS complement(1947236..1948771) product Phage portal protein, SPP1 family transl_table 11 codon_start 1 locus_tag LOCUS_17910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 CDS complement(1948782..1950059) product Phage terminase, large subunit, PBSX family transl_table 11 codon_start 1 locus_tag LOCUS_17920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169948.1 CDS complement(1950046..1950486) product terminase small subunit transl_table 11 codon_start 1 locus_tag LOCUS_17930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001838172.1 CDS complement(1950673..1951095) product Int gene activator RinA transl_table 11 codon_start 1 locus_tag LOCUS_17940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058632.1 CDS complement(1951119..1951265) product ORF116 transl_table 11 codon_start 1 locus_tag LOCUS_17950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990006.1 CDS complement(1951266..1951439) product Transcriptional activator RinB transl_table 11 codon_start 1 locus_tag LOCUS_17960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595245.1 CDS complement(1951442..1951642) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_17970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1951617..1951805) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_17980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1951802..1952047) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_17990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1952084..1952593) product dUTPase transl_table 11 codon_start 1 locus_tag LOCUS_18000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181819.1 CDS complement(1952586..1952828) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_18010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1952825..1953070) product Phi PVL orf 52-like protein transl_table 11 codon_start 1 locus_tag LOCUS_18020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065108.1 CDS complement(1953085..1953333) product ORF064 transl_table 11 codon_start 1 locus_tag LOCUS_18030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126846.1 CDS complement(1953334..1953693) product ORF039 transl_table 11 codon_start 1 locus_tag LOCUS_18040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140289.1 CDS complement(1953694..1953963) product ORF058 transl_table 11 codon_start 1 locus_tag LOCUS_18050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1953964..1954149) product ORF100 transl_table 11 codon_start 1 locus_tag LOCUS_18060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1954154..1954558) product ORF032 transl_table 11 codon_start 1 locus_tag LOCUS_18070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049784.1 CDS complement(1954569..1954790) product ORF065 transl_table 11 codon_start 1 locus_tag LOCUS_18080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123695.1 CDS complement(1954794..1955009) product ORF078 transl_table 11 codon_start 1 locus_tag LOCUS_18090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1955006..1956247) product Bacteriophage L54a, DnaB-like helicase family protein transl_table 11 codon_start 1 locus_tag LOCUS_18100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HMM9 CDS complement(1956244..1956600) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_18110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1956600..1957406) product ORF015 transl_table 11 codon_start 1 locus_tag LOCUS_18120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1957378..1958070) product Phi PV83 orf 19-like protein transl_table 11 codon_start 1 locus_tag LOCUS_18130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121803.1 CDS complement(1958083..1958637) product Single strand DNA binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1958667..1959446) product ORF016 transl_table 11 codon_start 1 locus_tag LOCUS_18150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1959447..1959983) product ORF022 transl_table 11 codon_start 1 locus_tag LOCUS_18160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674677.1 CDS complement(1959996..1960256) product ORF048 transl_table 11 codon_start 1 locus_tag LOCUS_18170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291483.1 CDS complement(1960237..1960566) product ORF047 transl_table 11 codon_start 1 locus_tag LOCUS_18180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1960656..1960817) product ORF098 transl_table 11 codon_start 1 locus_tag LOCUS_18190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048129.1 CDS complement(1960810..1961031) product ORF072 transl_table 11 codon_start 1 locus_tag LOCUS_18200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977378.1 CDS complement(1961045..1961494) product ORF029 transl_table 11 codon_start 1 locus_tag LOCUS_18210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1961536..1961760) product ORF073 transl_table 11 codon_start 1 locus_tag LOCUS_18220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187184.1 CDS complement(1961761..1962552) product ORF013 transl_table 11 codon_start 1 locus_tag LOCUS_18230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 CDS complement(1962709..1963017) product ORF049 transl_table 11 codon_start 1 locus_tag LOCUS_18240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1963032..1963250) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_18250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1963392..1964111 product ORF018 transl_table 11 codon_start 1 locus_tag LOCUS_18260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031454.1 CDS 1964181..1964348 product ORF096 transl_table 11 codon_start 1 locus_tag LOCUS_18270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694772.1 CDS 1964508..1964693 product PV83 orf 4-like protein-related protein transl_table 11 codon_start 1 locus_tag LOCUS_18280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1964729..1965634 product ORF013 transl_table 11 codon_start 1 locus_tag LOCUS_18290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1965571..1965771) product Excisionase transl_table 11 codon_start 1 locus_tag LOCUS_18300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1965883..1966929 product Integrase, phage family, putative transl_table 11 codon_start 1 locus_tag LOCUS_18310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145728.1 CDS 1966974..1968119 product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_18320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089621.1 CDS complement(1968379..1968909) product acyl-CoA thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_18330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184383.1 CDS complement(1968999..1970246) product aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_18340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795108.1 CDS complement(1970258..1970464) product UPF0435 protein SA1_35802 transl_table 11 codon_start 1 locus_tag LOCUS_18350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180460.1 CDS 1970605..1971069 product protein-tyrosine-phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene ptpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228666.1 CDS 1971076..1971351 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428172.1 CDS 1971629..1972846 product YihY/virulence factor BrkB family protein transl_table 11 codon_start 1 locus_tag LOCUS_18380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037075.1 CDS complement(1972962..1973591) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene vraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 CDS complement(1973581..1974624) product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene vraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017131.1 CDS complement(1974621..1975322) product transporter transl_table 11 codon_start 1 locus_tag LOCUS_18410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149064.1 CDS complement(1975337..1975723) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene orfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110179.1 CDS complement(1975940..1976698) product methionine aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene map inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636142.1 CDS 1977226..1978212 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_18440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999717.1 CDS complement(1978643..1979056) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557448.1 CDS complement(1979281..1980012) product glutamine amidotransferase transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene gatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544969.1 CDS complement(1980014..1981327) product Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene murT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250343.1 CDS 1981619..1982119 product non-heme ferritin transl_table 11 codon_start 1 locus_tag LOCUS_18480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949467.1 CDS 1982508..1983062 product DNA polymerase III subunit epsilon transl_table 11 codon_start 1 locus_tag LOCUS_18490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613738.1 CDS complement(1983130..1984200) product DNA polymerase IV transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene dinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140172.1 CDS complement(1984447..1984977) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548781.1 CDS complement(1985147..1986508) product RNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene rumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147865.1 CDS complement(1986589..1987536) product diacylglycerol kinase transl_table 11 codon_start 1 locus_tag LOCUS_18530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231451.1 CDS complement(1988119..1988265) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789566.1 CDS complement(1988305..1989732) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene gatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545370.1 CDS complement(1989745..1991202) product glutamyl-tRNA(Gln) amidotransferase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene gatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027919.1 CDS complement(1991204..1991506) product Aspartyl-tRNA(Asn)/glutamyl-tRNA amidotransferase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_18570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 CDS 1991873..1993411 product Sodium/proline symporter transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene putP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957020.1 CDS complement(1993500..1994699) product CamS family sex pheromone protein transl_table 11 codon_start 1 locus_tag LOCUS_18590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831700.1 CDS complement(1994712..1996715) product DNA ligase (NAD(+)) LigA transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene ligA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774556.1 CDS complement(1996719..1998911) product DNA helicase PcrA transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene pcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 CDS complement(1998908..1999600) product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene pcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272056.1 CDS complement(1999772..2000074) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165363.1 CDS complement(2000183..2001478) product adenylosuccinate lyase transl_table 11 codon_start 1 locus_tag LOCUS_18640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572878.1 CDS 2002339..2003505 product Staphopain A transl_table 11 codon_start 1 locus_tag LOCUS_18650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827746.1 CDS 2003536..2003862 product staphostatin A transl_table 11 codon_start 1 locus_tag LOCUS_18660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434933.1 CDS complement(2004154..2004327) product NETI motif-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669862.1 CDS complement(2004308..2004910) product DUF2179 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011542.1 CDS complement(2005181..2006002) product NAD(+) synthetase transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene nadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040866.1 CDS complement(2005995..2007464) product nicotinate phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_18700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284436.1 CDS 2007648..2008724 product nitric oxide synthase oxygenase transl_table 11 codon_start 1 locus_tag LOCUS_18710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897635.1 CDS 2008744..2009538 product Prephenate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_18720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177828.1 CDS complement(2009728..2011290) product sodium-dependent dicarboxylate transporter SdcS transl_table 11 codon_start 1 locus_tag LOCUS_18730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 CDS complement(2011495..2012592) product pectate lyase transl_table 11 codon_start 1 locus_tag LOCUS_18740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275727.1 CDS 2012964..2013524 product cysteine hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_18750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149686.1 CDS 2013577..2014506 product manganese-dependent inorganic pyrophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_18760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140871.1 CDS complement(2014701..2014865) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792184.1 CDS 2014926..2016305 product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021210.1 CDS complement(2016425..2017453) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181315.1 CDS 2017723..2018124 product YolD-like family protein transl_table 11 codon_start 1 locus_tag LOCUS_18800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205106.1 CDS complement(2018697..2018870) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267034.1 CDS 2019321..2020361 product choloylglycine hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_18820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188043.1 CDS complement(2020418..2021260) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713072.1 CDS complement(2021257..2021814) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033971.1 CDS complement(2021874..2022398) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_18850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966288.1 CDS 2022519..2023082 product thioredoxin family protein transl_table 11 codon_start 1 locus_tag LOCUS_18860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182842.1 CDS complement(2023148..2023888) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_18870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221651.1 CDS complement(2023888..2024760) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763043.1 CDS complement(2024757..2025437) product ABC-2 transporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_18890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645727.1 CDS complement(2025438..2026334) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991306.1 CDS complement(2026331..2026711) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_18910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691584.1 CDS complement(2026970..2027146) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681968.1 CDS 2027687..2028973 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 CDS complement(2029297..2029587) product MAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671712.1 CDS complement(2029598..2031352) product MAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557458.1 CDS 2031741..2031938 product Truncated beta-hemolysin transl_table 11 codon_start 1 locus_tag LOCUS_18960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549159.1 CDS 2032310..2032489 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669789.1 CDS complement(2033113..2033463) product Complement inhibitor transl_table 11 codon_start 1 locus_tag LOCUS_18980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702262.1 CDS 2034146..2034595 product CHIPS transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene chp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727645.1 CDS complement(2034690..2034986) product peptidoglycan hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_19000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110820.1 CDS complement(2035675..2036166) product Staphylokinase transl_table 11 codon_start 1 locus_tag LOCUS_19010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920038.1 CDS complement(2036357..2037112) product amidase transl_table 11 codon_start 1 locus_tag LOCUS_19020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861026.1 CDS complement(2037124..2037378) product holin transl_table 11 codon_start 1 locus_tag LOCUS_19030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611512.1 CDS complement(2037590..2037724) product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_19040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447039.1 CDS complement(2037916..2038212) product PhiPVL ORF17-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466784.1 CDS complement(2038270..2038557) product 77ORF044 transl_table 11 codon_start 1 locus_tag LOCUS_19060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262621.1 CDS complement(2038604..2038756) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000058.1 CDS complement(2038746..2042531) product Phage minor structural protein, N-terminal region domain protein transl_table 11 codon_start 1 locus_tag LOCUS_19080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582139.1 CDS complement(2042547..2044037) product Phi PVL orfs 18-19-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567396.1 CDS complement(2044037..2048689) product Lysostaphin transl_table 11 codon_start 1 locus_tag LOCUS_19100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504568.1 CDS complement(2048927..2049373) product Phi PVL orf 14-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2049438..2050391) product BIG2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2050392..2050772) product Phi PVL orf 12-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2050769..2051146) product Phage protein, HK97 gp10 family transl_table 11 codon_start 1 locus_tag LOCUS_19140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2051146..2051478) product Bacteriophage transl_table 11 codon_start 1 locus_tag LOCUS_19150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2051468..2051800) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2051809..2051967) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2052003..2053250) product Phage major capsid protein, HK97 family transl_table 11 codon_start 1 locus_tag LOCUS_19180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905714.1 CDS complement(2053338..2053922) product Prohead protease transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene pro inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2053915..2055165) product Portal protein transl_table 11 codon_start 1 locus_tag LOCUS_19200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2055171..2055371) product Phi PVL orf 3-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2055385..2057079) product Phage terminase-large subunit transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene terL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296487.1 CDS complement(2057082..2057549) product Phage terminase-small subunit transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene terS inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2057679..2058032) product Phage endonuclease transl_table 11 codon_start 1 locus_tag LOCUS_19240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101793.1 CDS complement(2058039..2058491) product Phi PVL orf 62-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2058606..2059076) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2059099..2059299) product Phage77_ORF071 transl_table 11 codon_start 1 locus_tag LOCUS_19270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557462.1 CDS complement(2059299..2059448) product transcriptional activator RinB transl_table 11 codon_start 1 locus_tag LOCUS_19280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595265.1 CDS complement(2059445..2059651) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195779.1 CDS complement(2059668..2059841) product Hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209219.1 CDS complement(2059878..2060414) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185680.1 CDS complement(2060407..2060577) product Hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2060564..2060818) product Phi PVL/orf 52-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065109.1 CDS complement(2060811..2061200) product PV83 orf 27-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072467505.1 CDS complement(2061197..2061544) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286547.1 CDS complement(2061608..2061856) product Phi PVL orf 51-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126846.1 CDS complement(2061857..2062228) product Phi PVL orf 50-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140289.1 CDS complement(2062229..2062414) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2062419..2062823) product ORF033 transl_table 11 codon_start 1 locus_tag LOCUS_19390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049784.1 CDS complement(2062834..2063055) product ORF067 transl_table 11 codon_start 1 locus_tag LOCUS_19400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123695.1 CDS complement(2063068..2063226) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628836.1 CDS complement(2063220..2063999) product DNA replication protein DnaC transl_table 11 codon_start 1 locus_tag LOCUS_19420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443353.1 CDS complement(2064009..2064779) product Rep protein transl_table 11 codon_start 1 locus_tag LOCUS_19430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2064845..2065126 product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414755.1 CDS complement(2065119..2065268) product Orf49 transl_table 11 codon_start 1 locus_tag LOCUS_19450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2065265..2065936) product Phi ETA orf 20-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121803.1 CDS complement(2065949..2066500) product single-stranded DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_19470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2066531..2067310) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2067303..2067524) product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815401.1 CDS complement(2067534..2067794) product Phi PVL orf 39-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291510.1 CDS complement(2067887..2068048) product ORF098 transl_table 11 codon_start 1 locus_tag LOCUS_19510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048129.1 CDS complement(2068045..2068365) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120197.1 CDS 2068424..2069056 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275058.1 CDS complement(2069071..2069211) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939496.1 CDS complement(2069242..2069439) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148861.1 CDS complement(2069455..2069616) product Putative phage anti-repressor protein transl_table 11 codon_start 1 locus_tag LOCUS_19560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(2069848..2070204) product Anti repressor transl_table 11 codon_start 1 locus_tag LOCUS_19570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2070261..2070800 product Phi PVL orf 33-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351243.1 CDS complement(2070824..2071084) product Phi PVL orf 32-like protein transl_table 11 codon_start 1 locus_tag LOCUS_19590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435341.1 CDS complement(2071102..2071326) product Repressor-like protein-related protein transl_table 11 codon_start 1 locus_tag LOCUS_19600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905683.1 CDS 2071485..2072255 product Repressor transl_table 11 codon_start 1 locus_tag LOCUS_19610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083967.1 CDS 2072469..2072636 product Conserved hypothetical phage protein transl_table 11 codon_start 1 locus_tag LOCUS_19620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694772.1 CDS 2072693..2072818 product ORF136 transl_table 11 codon_start 1 locus_tag LOCUS_19630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2072815..2073429) product Na/K ATPase transl_table 11 codon_start 1 locus_tag LOCUS_19640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2073537..2074574 product Integrase transl_table 11 codon_start 1 locus_tag LOCUS_19650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857180.1 CDS 2074631..2075455 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283440.1 CDS complement(2075693..2076709) product gamma-hemolysin subunit B transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene lukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595392.1 CDS complement(2076731..2077786) product succinyl-diaminopimelate desuccinylase transl_table 11 codon_start 1 locus_tag LOCUS_19680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791411.1 CDS 2078221..2079444 product succinyl-diaminopimelate desuccinylase transl_table 11 codon_start 1 locus_tag LOCUS_19690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206625.1 CDS complement(2079816..2080661) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824908.1 CDS complement(2080723..2081634) product ferrichrome-binding protein FhuD transl_table 11 codon_start 1 locus_tag LOCUS_19710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825515.1 CDS 2081795..2083102 product potassium transporter KtrB transl_table 11 codon_start 1 locus_tag LOCUS_19720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045079.1 CDS complement(2083955..2084398) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836809.1 CDS complement(2084504..2084905) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2085259..2085849) product terminase small subunit transl_table 11 codon_start 1 locus_tag LOCUS_19750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293076.1 CDS complement(2085846..2086061) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001807583.1 CDS 2086191..2086538 product site-specific integrase transl_table 11 codon_start 1 locus_tag LOCUS_19770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2086129,2086406 CDS complement(2086760..2088376) product Chaperonin GroEL transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene groEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240642.1 CDS complement(2088452..2088736) product co-chaperone GroES transl_table 11 codon_start 1 locus_tag LOCUS_19790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917289.1 CDS 2088911..2089654 product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_19800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197635.1 CDS complement(2089679..2090938) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2091135..2091761 product nitroreductase transl_table 11 codon_start 1 locus_tag LOCUS_19820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522381.1 CDS 2092122..2092907 product hydrolase in agr operon transl_table 11 codon_start 1 locus_tag LOCUS_19830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867951.1 CDS complement(2093504..2093641) product Delta-hemolysin transl_table 11 codon_start 1 locus_tag LOCUS_19840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549197.1 CDS 2093820..2094443 product accessory gene regulator AgrB transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene agrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105696.1 CDS 2094440..2094580 product cyclic lactone autoinducer peptide transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene agrD_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2094605..2095897 product Staphylococcal accessory gene regulator protein C transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene agrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447888.1 CDS 2095916..2096632 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_19880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688492.1 CDS complement(2096999..2097958) product carbohydrate kinase transl_table 11 codon_start 1 locus_tag LOCUS_19890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253312.1 CDS complement(2097955..2099439) product sucrose-6-phosphate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene scrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 CDS complement(2099588..2100538) product LacI family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene scrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790331.1 CDS complement(2100721..2101971) product ammonia permease transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene amt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052270.1 CDS complement(2102179..2102403) product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_19930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581076.1 CDS complement(2102463..2103542) product 5S ribosomal RNA transl_table 11 codon_start 1 locus_tag LOCUS_19940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072414299.1 CDS complement(2103846..2104481) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_19950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283612.1 CDS 2104734..2106662 product ABC transporter, ATP-binding protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_19960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 CDS 2107024..2108634 product DNA mismatch repair protein MutS transl_table 11 codon_start 1 locus_tag LOCUS_19970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106332.1 CDS complement(2108736..2109761) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene tsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159041.1 CDS complement(2109754..2110218) product [Ribosomal protein S18]-alanine N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene rimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447043.1 CDS complement(2110191..2110853) product TsaD domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086737.1 CDS complement(2110834..2111295) product t(6)A37 threonylcarbamoyladenosine biosynthesis protein TsaE transl_table 11 codon_start 1 locus_tag LOCUS_20010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014532666.1 CDS 2111806..2113494 product Dihydroxy-acid dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene ilvD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255780.1 CDS 2113522..2115291 product acetolactate synthase, large subunit, biosynthetic type transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene ilvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047811.1 CDS 2115291..2115545 product acetolactate synthase transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene ilvN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196911.1 CDS 2115682..2116686 product ketol-acid reductoisomerase transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene ilvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214552.1 CDS 2116716..2118245 product 2-isopropylmalate synthase transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene leuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094583.1 CDS 2118248..2119294 product 3-isopropylmalate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene leuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221945.1 CDS 2119308..2120678 product 3-isopropylmalate dehydratase large subunit transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene leuC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531823.1 CDS 2120679..2121251 product 3-isopropylmalate dehydratase small subunit transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene leuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718953.1 CDS 2121266..2122534 product L-threonine dehydratase biosynthetic IlvA transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene ilvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216856.1 rRNA complement(2122779..2122856) product cyclic lactone autoinducer peptide locus_tag LOCUS_r00110 gene agrD_2 inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA rRNA complement(2122933..2125851) product 23S ribosomal RNA locus_tag LOCUS_r00120 inference COORDINATES:profile:Barrnap:0.8 rRNA complement(2126403..2127951) product 16S ribosomal RNA locus_tag LOCUS_r00130 inference COORDINATES:profile:Barrnap:0.8 tRNA complement(2128072..2128145) product tRNA-Gly locus_tag LOCUS_t00530 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(2128168..2128250) product 3-isopropylmalate dehydratase large subunit locus_tag LOCUS_t00540 gene leuC_2 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(2128897..2129352) product SprT family protein transl_table 11 codon_start 1 locus_tag LOCUS_20110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058111.1 CDS complement(2129345..2131495) product RNA-binding transcriptional accessory protein transl_table 11 codon_start 1 locus_tag LOCUS_20120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 CDS complement(2131929..2132699) product RNA polymerase sigma factor SigB transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene rpoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041111.1 CDS complement(2132674..2133153) product Serine-protein kinase RsbW transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene rsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447044.1 CDS complement(2133155..2133481) product anti-sigma B factor antagonist transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene rsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052491.1 CDS complement(2133600..2134388) product SigmaB regulation protein RsbU, putative transl_table 11 codon_start 1 locus_tag LOCUS_20160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390829.1 note frameshifted, insertion/deletion at around 2134374 CDS complement(2134363..2134590) product SigmaB regulation protein RsbU, putative transl_table 11 codon_start 1 locus_tag LOCUS_20170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2134374 CDS complement(2134939..2135301) product mRNA interferase MazF transl_table 11 codon_start 1 locus_tag LOCUS_20180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621175.1 CDS complement(2135298..2135468) product antitoxin MazE transl_table 11 codon_start 1 locus_tag LOCUS_20190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948331.1 CDS complement(2135553..2136701) product alanine racemase transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene alr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281154.1 CDS complement(2136767..2137126) product holo-ACP synthase transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene acpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581197.1 CDS complement(2137130..2137621) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_20220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205912.1 CDS complement(2137608..2139191) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294626.1 CDS complement(2139184..2139663) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287087.1 CDS complement(2139872..2140432) product potassium-transporting ATPase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene kdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092411.1 CDS complement(2140452..2142479) product potassium-transporting ATPase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene kdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546611.1 CDS complement(2142498..2144174) product potassium-transporting ATPase A chain transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene kdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402651.1 CDS 2144446..2147103 product Histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene kdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072278.1 CDS 2147103..2147798 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene kdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190841.1 CDS complement(2148167..2149687) product DEAD/DEAH box family ATP-dependent RNA helicase transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene cshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178942.1 CDS complement(2150204..2151562) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene murF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611464.1 CDS complement(2151577..2152647) product D-alanine--D-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene ddl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159631.1 CDS 2152965..2154167 product cell division protein FtsW transl_table 11 codon_start 1 locus_tag LOCUS_20330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109939.1 CDS complement(2154431..2154568) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828354.1 CDS complement(2154696..2154905) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581792.1 CDS complement(2154917..2155210) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138932.1 CDS 2155376..2156860 product cardiolipin synthase transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene cls inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 CDS 2156888..2157535 product phosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_20380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187630.1 CDS 2157896..2158108 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2158348..2159220) product protein translocase component YidC transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene yidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725802.1 CDS complement(2159306..2159947) product thiamine phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene thiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483153.1 CDS complement(2159949..2160740) product hydroxyethylthiazole kinase transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene thiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108483.1 CDS complement(2160724..2161554) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene thiD_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594954.1 CDS complement(2161547..2162236) product Aminopyrimidine aminohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene tenA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396077.1 CDS complement(2162622..2163317) product transglycosylase SceD transl_table 11 codon_start 1 locus_tag LOCUS_20450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752005.1 CDS complement(2163706..2164101) product single-stranded DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_20460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932694.1 CDS 2164295..2164735 product YwpF protein transl_table 11 codon_start 1 locus_tag LOCUS_20470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789631.1 CDS complement(2164794..2165234) product beta-hydroxyacyl-ACP dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_20480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 CDS complement(2165268..2166533) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene murA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358006.1 CDS complement(2166644..2166877) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_20500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384523.1 CDS complement(2167439..2167843) product ATP synthase epsilon chain transl_table 11 codon_start 1 locus_tag LOCUS_20510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094394.1 CDS complement(2167863..2169275) product ATP synthase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_20520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511135.1 CDS complement(2169297..2170163) product ATP synthase subunit gamma transl_table 11 codon_start 1 locus_tag LOCUS_20530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157603.1 CDS complement(2170194..2171702) product ATP synthase F1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974881.1 CDS complement(2171724..2172263) product ATP synthase subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene atpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241344.1 CDS complement(2172263..2172784) product ATP synthase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene atpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140679.1 CDS complement(2172982..2173194) product ATP synthase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_20570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNJ2 CDS complement(2173237..2173965) product ATP synthase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_20580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349655.1 CDS complement(2173986..2174339) product ATP synthase transl_table 11 codon_start 1 locus_tag LOCUS_20590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2174506..2175636) product UDP-GlcNAc 2-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene mnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723418.1 CDS complement(2175657..2176286) product uracil phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 CDS complement(2176314..2177552) product serine hydroxymethyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120494.1 CDS complement(2177579..2178103) product TIGR01440 family protein transl_table 11 codon_start 1 locus_tag LOCUS_20630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654184.1 CDS complement(2178210..2178629) product protein-tyrosine-phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_20640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697334.1 CDS complement(2178626..2179672) product threonylcarbamoyl-AMP synthase transl_table 11 codon_start 1 locus_tag LOCUS_20650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445903.1 CDS complement(2179756..2180592) product protein-(glutamine-N5) methyltransferase, release factor-specific transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene prmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248732.1 CDS complement(2180579..2181655) product peptide chain release factor 1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene prfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460242.1 CDS complement(2181656..2182255) product thymidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene tdk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273358.1 CDS complement(2182602..2182856) product 50S ribosomal protein L31 type B transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene rpmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808968.1 CDS complement(2182974..2184290) product Transcription termination factor Rho transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115101.1 CDS complement(2184537..2185964) product aldehyde dehydrogenase family protein transl_table 11 codon_start 1 locus_tag LOCUS_20710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206093.1 CDS complement(2186202..2186537) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_20720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451438.1 CDS complement(2186626..2187885) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene murA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046602.1 CDS complement(2188351..2189211) product fructose-bisphosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene fba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131841.1 CDS 2189429..2189950 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036002.1 CDS complement(2190059..2191669) product CTP synthase transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene pyrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159960.1 CDS complement(2192005..2192535) product DNA-directed RNA polymerase subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_20770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701483.1 CDS complement(2192647..2193507) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040743.1 CDS 2193931..2194734 product type II pantothenate kinase transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene coaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862728.1 CDS complement(2194864..2195535) product DUF2750 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120549.1 CDS complement(2195934..2197127) product ATP-grasp domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183717.1 CDS complement(2197127..2198311) product aminobenzoyl-glutamate utilization protein B transl_table 11 codon_start 1 locus_tag LOCUS_20820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291497.1 CDS 2198622..2199092 product S-ribosylhomocysteine lyase transl_table 11 codon_start 1 locus_tag LOCUS_20830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164421.1 CDS complement(2199244..2199594) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_20840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024035.1 CDS complement(2199608..2200909) product pyrimidine-nucleoside phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene pdp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 CDS complement(2201188..2201850) product 2-deoxyribose-5-phosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene deoC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083318.1 CDS 2202165..2202875 product purine-nucleoside phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene deoD_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 CDS complement(2202996..2203439) product DNA starvation/stationary phase protection protein transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070866.1 CDS complement(2203639..2204052) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123303.1 CDS complement(2204510..2205883) product EVE domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123398.1 CDS complement(2206555..2206785) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808817.1 CDS complement(2206816..2207646) product mannose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene manA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127960.1 CDS complement(2207609..2207755) product Mannose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene manA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2207662 CDS complement(2208190..2208855) product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024095.1 CDS 2209007..2209327 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene arsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003759.1 CDS 2209329..2210309 product cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_20960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019734.1 CDS 2210575..2211666 product lytic regulatory protein transl_table 11 codon_start 1 locus_tag LOCUS_20970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495669.1 CDS complement(2212638..2212841) product resolvase transl_table 11 codon_start 1 locus_tag LOCUS_20980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2212818 note possible pseudo due to internal stop codon CDS complement(2212900..2214036) product SAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2215122..2215979) product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_21000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370925.1 CDS complement(2216047..2216829) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908182.1 CDS complement(2217061..2218866) product glutamine--fructose-6-phosphate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene glmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334463.1 CDS 2219547..2221085 product PTS mannitol transporter subunit IICB transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene mtlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083807.1 CDS 2221120..2223252 product EIIA transl_table 11 codon_start 1 locus_tag LOCUS_21040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927371.1 CDS 2223264..2223698 product mannitol-specific phosphotransferase enzyme IIA component transl_table 11 codon_start 1 locus_tag LOCUS_21050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292149.1 CDS 2223698..2224804 product Mannitol-1-phosphate 5-dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene mtlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648723.1 CDS complement(2225123..2232559) product DUF1542 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048266.1 CDS complement(2232836..2234191) product phosphoglucosamine mutase transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene glmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521495.1 CDS complement(2234218..2235150) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894032.1 CDS complement(2235152..2235961) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene dacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347896.1 CDS complement(2236150..2237058) product arginase transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene rocF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 CDS 2237284..2238486 product ISL3 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene tnp_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557163.1 tRNA complement(2238716..2238789) product tRNA-Lys locus_tag LOCUS_t00550 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(2238793..2238867) product tRNA-Gln locus_tag LOCUS_t00560 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(2238877..2238960) product tRNA-Tyr locus_tag LOCUS_t00570 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(2238990..2239065) product tRNA-Val locus_tag LOCUS_t00580 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(2239072..2239145) product Ribosome maturation factor RimM (Fragment) locus_tag LOCUS_t00590 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(2239146..2239220) product tRNA-Asn locus_tag LOCUS_t00600 inference COORDINATES:profile:Aragorn:1.2.38 rRNA complement(2239266..2239343) product tRNA-Asn locus_tag LOCUS_r00140 inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA rRNA complement(2239420..2242338) product 23S ribosomal RNA locus_tag LOCUS_r00150 inference COORDINATES:profile:Barrnap:0.8 tRNA complement(2242631..2242707) product tRNA-Ile locus_tag LOCUS_t00610 inference COORDINATES:profile:Aragorn:1.2.38 rRNA complement(2242803..2244353) product 16S ribosomal RNA locus_tag LOCUS_r00160 inference COORDINATES:profile:Barrnap:0.8 CDS complement(2244932..2245879) product chromosome partitioning protein ParA transl_table 11 codon_start 1 locus_tag LOCUS_21130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958531.1 CDS complement(2246027..2247469) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_21140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141007.1 CDS complement(2247791..2248258) product multidrug resistance efflux pump SepA transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene sepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636857.1 CDS complement(2248363..2249706) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_21160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237506.1 CDS complement(2249883..2250566) product hemolysin III transl_table 11 codon_start 1 locus_tag LOCUS_21170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047255.1 CDS complement(2250585..2251772) product uridylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_21180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884735.1 CDS complement(2251816..2252331) product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_21190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147095.1 CDS 2252508..2252768 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251935.1 CDS complement(2252900..2254270) product Conserved hypotehtical protein transl_table 11 codon_start 1 locus_tag LOCUS_21210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447051.1 CDS complement(2254506..2255474) product iron-dicitrate ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_21220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989088.1 CDS complement(2255471..2256502) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_21230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974909.1 CDS complement(2256514..2257497) product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214661.1 CDS complement(2257889..2258959) product alanine racemase transl_table 11 codon_start 1 locus_tag LOCUS_21250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951624.1 CDS complement(2258966..2260723) product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_21260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262640.1 CDS complement(2260710..2261903) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_21270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170400.1 CDS 2262005..2263981 product Aerobactin synthase transl_table 11 codon_start 1 locus_tag LOCUS_21280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052571.1 CDS 2264437..2265237 product DUF772 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2265105 CDS 2265255..2265554 product DDE_Tnp_1 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2265105 note possible pseudo due to internal stop codon CDS 2265717..2266061 product DDE_Tnp_1 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874022.1 CDS complement(2266097..2266606) product Asp23/Gls24 family envelope stress response protein transl_table 11 codon_start 1 locus_tag LOCUS_21320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215236.1 CDS complement(2266669..2266908) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002683.1 CDS complement(2266921..2267457) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825819.1 CDS complement(2267632..2269194) product glycine/betaine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_21350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792342.1 CDS complement(2269501..2270502) product zinc-binding alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_21360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781951.1 CDS complement(2270736..2271737) product NADP-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_21370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180222.1 CDS complement(2272020..2272889) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_21380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792547.1 CDS complement(2273155..2274567) product 6-phospho-beta-galactosidase transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene lacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169224.1 CDS complement(2274585..2276297) product PTS lactose EIICB component transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene lacE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983330.1 CDS complement(2276303..2276614) product lactose-specific phosphotransferase enzyme IIA component transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene lacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078309.1 CDS complement(2276636..2277616) product tagatose 1,6-diphosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene lacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047009.1 CDS complement(2277620..2278552) product tagatose-6-phosphate kinase transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene lacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604134.1 CDS complement(2278565..2279080) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CPH6 CDS complement(2279096..2279524) product Galactose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_21450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRJ2 CDS complement(2279892..2280647) product DeoR/GlpR transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_21460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795316.1 CDS 2280898..2281629 product NAD-dependent protein deacylase transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene cobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557494.1 CDS complement(2281920..2282528) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181592.1 CDS complement(2283135..2283983) product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_21490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015500.1 CDS complement(2284053..2284469) product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_21500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850015.1 CDS 2284877..2287300 product hyaluronate lyase transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene hysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222267.1 CDS complement(2287360..2288214) product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_21520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044441.1 CDS complement(2288425..2289240) product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_21530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044362.1 CDS 2289534..2289959 product toxin transl_table 11 codon_start 1 locus_tag LOCUS_21540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769705.1 CDS complement(2290323..2291027) product alpha-acetolactate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene budA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186134.1 CDS complement(2291064..2292728) product Acetolactate synthase, putative transl_table 11 codon_start 1 locus_tag LOCUS_21560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130149.1 CDS 2292991..2293200 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2293182..2293364) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655241.1 CDS complement(2293918..2295324) product Conserved domain protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_21590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2295453..2296589) product ATP-dependent Clp protease ATP-binding subunit transl_table 11 codon_start 1 locus_tag LOCUS_21600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2296639..2297382) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2297395..2297688) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2297687 CDS complement(2297685..2298782) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2299011,2298885,2297687 CDS complement(2299327..2299719) product 30S ribosomal protein S9 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene rpsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001790547.1 CDS complement(2299739..2300176) product 50S ribosomal protein L13 transl_table 11 codon_start 1 locus_tag LOCUS_21650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 CDS complement(2300416..2301219) product tRNA pseudouridine(38-40) synthase TruA transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene truA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221853.1 CDS complement(2301224..2302030) product energy-coupling factor transporter protein EcfT transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene ecfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791620.1 CDS complement(2302020..2302880) product energy-coupling factor transporter ATPase transl_table 11 codon_start 1 locus_tag LOCUS_21680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155386.1 CDS complement(2302877..2303686) product energy-coupling factor transporter ATPase transl_table 11 codon_start 1 locus_tag LOCUS_21690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389658.1 CDS complement(2304224..2304592) product 50S ribosomal protein L17 transl_table 11 codon_start 1 locus_tag LOCUS_21700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542274.1 CDS complement(2304609..2305553) product DNA-directed RNA polymerase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_21710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569649.1 CDS complement(2305628..2306017) product 30S ribosomal protein S11 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene rpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 CDS complement(2306041..2306406) product 30S ribosomal protein S13 transl_table 11 codon_start 1 locus_tag LOCUS_21730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 CDS complement(2306574..2306792) product translation initiation factor IF-1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene infA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 CDS complement(2306985..2307632) product adenylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene adk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021468.1 CDS complement(2307649..2308941) product protein translocase subunit SecY transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene secY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616784.1 CDS complement(2308941..2309381) product 50S ribosomal protein L15 transl_table 11 codon_start 1 locus_tag LOCUS_21770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 CDS complement(2309398..2309577) product 50S ribosomal protein L30 transl_table 11 codon_start 1 locus_tag LOCUS_21780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 CDS complement(2309594..2310094) product 30S ribosomal protein S5 transl_table 11 codon_start 1 locus_tag LOCUS_21790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 CDS complement(2310115..2310474) product 50S ribosomal protein L18 transl_table 11 codon_start 1 locus_tag LOCUS_21800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 CDS complement(2310505..2311041) product 50S ribosomal protein L6 transl_table 11 codon_start 1 locus_tag LOCUS_21810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091975.1 CDS complement(2311066..2311464) product 30S ribosomal protein S8 transl_table 11 codon_start 1 locus_tag LOCUS_21820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178881.1 CDS complement(2311496..2311681) product 30S ribosomal protein S14 type Z transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene rpsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140799.1 CDS complement(2311704..2312243) product 50S ribosomal protein L5 transl_table 11 codon_start 1 locus_tag LOCUS_21840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 CDS complement(2312270..2312587) product 50S ribosomal protein L24 transl_table 11 codon_start 1 locus_tag LOCUS_21850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 CDS complement(2312623..2312991) product 50S ribosomal protein L14 transl_table 11 codon_start 1 locus_tag LOCUS_21860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615921.1 CDS complement(2313023..2313286) product 30S ribosomal protein S17 transl_table 11 codon_start 1 locus_tag LOCUS_21870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004085.1 CDS complement(2313310..2313519) product 50S ribosomal protein L29 transl_table 11 codon_start 1 locus_tag LOCUS_21880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 CDS complement(2313509..2313943) product 50S ribosomal protein L16 transl_table 11 codon_start 1 locus_tag LOCUS_21890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 CDS complement(2313946..2314599) product 30S ribosomal protein S3 transl_table 11 codon_start 1 locus_tag LOCUS_21900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529877.1 CDS complement(2314623..2314976) product 50S ribosomal protein L22 transl_table 11 codon_start 1 locus_tag LOCUS_21910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 CDS complement(2315005..2315283) product 30S ribosomal protein S19 transl_table 11 codon_start 1 locus_tag LOCUS_21920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 CDS complement(2315350..2316183) product 50S ribosomal protein L2 transl_table 11 codon_start 1 locus_tag LOCUS_21930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985472.1 CDS complement(2316216..2316491) product 50S ribosomal protein L23 transl_table 11 codon_start 1 locus_tag LOCUS_21940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388082.1 CDS complement(2316491..2317114) product 50S ribosomal protein L4 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene rplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 CDS complement(2317141..2317803) product 50S ribosomal protein L3 transl_table 11 codon_start 1 locus_tag LOCUS_21960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160212.1 CDS complement(2317831..2318139) product 30S ribosomal protein S10 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene rpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 CDS 2318496..2318885 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788443.1 CDS complement(2319077..2320411) product NCS2 family permease transl_table 11 codon_start 1 locus_tag LOCUS_21990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800700.1 CDS complement(2320524..2322659) product DNA topoisomerase 3 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene topB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838479.1 CDS 2322846..2323733 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029536.1 CDS 2323914..2324777 product glucose uptake protein GlcU transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene glcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159898.1 CDS complement(2325196..2326104) product AEC family malonate efflux carrier transl_table 11 codon_start 1 locus_tag LOCUS_22030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445917.1 CDS 2326237..2326401 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051210.1 CDS 2326646..2326963 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161085.1 CDS complement(2327150..2330317) product AcrB/AcrD/AcrF family protein transl_table 11 codon_start 1 locus_tag LOCUS_22060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592307.1 CDS complement(2330434..2331699) product lipid II:glycine glycyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene fmhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413862.1 CDS complement(2332331..2333095) product Glyoxalase-like_dom domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600967.1 CDS 2333257..2333697 product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951058.1 CDS 2333690..2334901 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_22100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184404.1 CDS complement(2335005..2335355) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066900.1 repeat_region 2335711..2335904 rpt_family CRISPR rpt_type direct rpt_unit_seq tgttggggccccgccaacttgca inference COORDINATES:alignment:CRT:1.2 CDS complement(2336046..2337068) product cyclic pyranopterin monophosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene moaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230173.1 CDS complement(2337088..2337687) product molybdenum cofactor guanylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643986.1 CDS complement(2337694..2337927) product molybdopterin synthase sulfur carrier subunit transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene moaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866971.1 CDS complement(2337933..2338379) product molybdopterin synthase catalytic subunit transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene moaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808495.1 CDS complement(2338393..2338878) product molybdopterin-guanine dinucleotide biosynthesis protein B transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene mobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602950.1 CDS complement(2338875..2340134) product molybdopterin molybdenumtransferase transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene moeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259717.1 tRNA complement(2340343..2340435) product cyclic pyranopterin monophosphate synthase MoaC locus_tag LOCUS_t00620 gene moaC inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(2340693..2341199) product molybdenum cofactor biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_22180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503822.1 CDS complement(2341230..2342234) product molybdopterin biosynthesis protein MoeB transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene moeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076930.1 CDS complement(2342404..2343009) product molybdenum ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene modC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913024.1 CDS complement(2343010..2343681) product molybdenum ABC transporter permease subunit transl_table 11 codon_start 1 locus_tag LOCUS_22210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113093.1 CDS complement(2343695..2344477) product molybdate ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene modA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782736.1 CDS 2344767..2345564 product sulfurtransferase FdhD transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene fdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030823.1 CDS complement(2345736..2346506) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146747.1 CDS complement(2346578..2347132) product Biotin transporter transl_table 11 codon_start 1 locus_tag LOCUS_22250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208742.1 CDS complement(2347253..2348194) product purine nucleosidase transl_table 11 codon_start 1 locus_tag LOCUS_22260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163416.1 CDS complement(2348207..2348395) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2348593..2349501) product ferrichrome ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_22280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735038.1 CDS complement(2349715..2349891) product Acyl-CoA_dh_2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2349998 note possible pseudo due to internal stop codon CDS complement(2350014..2350880) product acyl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_22300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999205.1 note frameshifted, insertion/deletion at around 2349998 note possible pseudo due to internal stop codon CDS complement(2351097..2352002) product Urea transporter transl_table 11 codon_start 1 locus_tag LOCUS_22310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800836.1 CDS 2352262..2352564 product urease subunit gamma transl_table 11 codon_start 1 locus_tag LOCUS_22320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545928.1 CDS 2352578..2352988 product Urease subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene ureB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612126.1 CDS 2352985..2354700 product urease subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene ureC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008673.1 CDS 2354713..2355165 product urease accessory protein UreE transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene ureE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634589.1 CDS 2355158..2355847 product urease accessory protein UreF transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene ureF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 CDS 2355860..2356474 product urease accessory protein UreG transl_table 11 codon_start 1 locus_tag LOCUS_22370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002973.1 CDS 2356474..2357310 product urease accessory protein transl_table 11 codon_start 1 locus_tag LOCUS_22380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344352.1 CDS complement(2357499..2357846) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036076.1 CDS complement(2358274..2358600) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599589.1 CDS complement(2358664..2359407) product Transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032848.1 CDS complement(2359433..2361388) product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131842.1 CDS 2361998..2362801 product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene ssaA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717381.1 CDS complement(2362818..2363060) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789136.1 CDS complement(2363234..2364634) product Na+/H+ antiporter NhaC transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene nhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977739.1 CDS complement(2364729..2365811) product octopine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_22460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 CDS 2366059..2366481 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_22470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206114.1 CDS 2366718..2367218 product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene ssaA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737705.1 CDS 2367580..2368533 product 2-hydroxyacid dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene pdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417018.1 CDS complement(2368625..2369749) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 CDS complement(2370060..2370836) product Putative N-acetylmuramoyl-L-alanine amidase transl_table 11 codon_start 1 locus_tag LOCUS_22510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447058.1 CDS complement(2370858..2371109) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_22520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921246.1 CDS complement(2371319..2371792) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840811.1 CDS complement(2371792..2374746) product formate dehydrogenase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_22540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155278.1 CDS complement(2375348..2376295) product Transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792529.1 CDS complement(2376428..2377225) product inositol monophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_22560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130454.1 CDS 2377610..2378302 product YafY family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030125.1 CDS 2378658..2378972 product transporter transl_table 11 codon_start 1 locus_tag LOCUS_22580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2378855 CDS complement(2378949..2379686) product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_22590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426696.1 CDS 2379735..2380064 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606726.1 CDS 2380509..2381381 product MurR/RpiR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073195.1 CDS complement(2381768..2383147) product alanine glycine permease transl_table 11 codon_start 1 locus_tag LOCUS_22620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429674.1 CDS 2383427..2383783 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917669.1 CDS 2383780..2383965 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205307.1 CDS complement(2384061..2384252) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971980.1 CDS complement(2384263..2384898) product haloacid dehalogenase transl_table 11 codon_start 1 locus_tag LOCUS_22660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285450.1 CDS complement(2384973..2385890) product sodium transporter transl_table 11 codon_start 1 locus_tag LOCUS_22670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 CDS 2386157..2386687 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904065.1 CDS complement(2386753..2388357) product PTS system, arbutin-like IIBC component transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene glvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991504.1 CDS 2388687..2389451 product MurR/RpiR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477989.1 CDS complement(2389509..2390015) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051556.1 CDS complement(2390182..2391495) product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_22720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451828.1 CDS complement(2391720..2392289) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185190.1 CDS complement(2392776..2393657) product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_22740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235289.1 CDS complement(2393768..2394889) product M20_dimer domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523157.1 CDS complement(2395166..2396404) product imidazolonepropionase transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene hutI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998753.1 CDS complement(2396404..2398065) product urocanate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene hutU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 CDS 2398225..2399109 product LysR family regulatory protein transl_table 11 codon_start 1 locus_tag LOCUS_22780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691839.1 CDS 2399531..2399950 product metallothiol transferase FosB transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene fosB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920239.1 CDS complement(2400206..2401141) product formimidoylglutamase transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene hutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277968.1 CDS 2401431..2402690 product CAAX amino terminal protease family protein transl_table 11 codon_start 1 locus_tag LOCUS_22810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794442.1 CDS complement(2402756..2403442) product ribose-5-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene rpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655864.1 CDS 2403616..2404269 product MOSC domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623440.1 CDS complement(2404505..2405524) product galactose mutarotase transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene galM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634677.1 CDS complement(2405554..2405880) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_22850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966695.1 CDS complement(2405929..2406114) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789152.1 CDS complement(2406098..2407330) product sodium ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_22870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548702.1 CDS complement(2407323..2408222) product sodium ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_22880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 CDS complement(2408453..2409100) product DUF805 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436823.1 CDS 2409499..2410107 product DNA-3-methyladenine glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_22900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348300.1 CDS 2410444..2411652 product sodium/glutamate symporter transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene gltS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571591.1 CDS complement(2411700..2412749) product type 2 isopentenyl-diphosphate Delta-isomerase transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene fni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279375.1 CDS complement(2412780..2413727) product cobalt transporter CorA transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene corA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185431.1 CDS 2413782..2414315 product Putative cytosolic protein transl_table 11 codon_start 1 locus_tag LOCUS_22940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234727.1 CDS 2414312..2414731 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128655.1 CDS complement(2414839..2415759) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_22960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620864.1 CDS 2415967..2416605 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184229.1 CDS complement(2416851..2418782) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_22980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213885.1 CDS complement(2418795..2419442) product HlyD family secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_22990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738250.1 CDS 2419563..2420114 product TetR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828569.1 CDS complement(2420344..2420622) product Teicoplanin resistance-associated Bcr/CflA subfamily drug resistance transporter, putative transl_table 11 codon_start 1 locus_tag LOCUS_23010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2420618 CDS complement(2420613..2421551) product Bcr/CflA family efflux transporter transl_table 11 codon_start 1 locus_tag LOCUS_23020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999131.1 note frameshifted, insertion/deletion at around 2420618 CDS complement(2421820..2423202) product zinc ribbon domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833794.1 CDS complement(2423442..2423579) product 5S ribosomal RNA transl_table 11 codon_start 1 locus_tag LOCUS_23040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(2423661..2423897) product HTH marR-type domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2424092..2425060 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_23060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549718.1 CDS 2425635..2425991 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2426131..2426796) product hemin ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229920.1 CDS complement(2426796..2427851) product hemin ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_23090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761395.1 CDS 2427987..2428661 product Two-component response regulator colocalized with HrtAB transporter transl_table 11 codon_start 1 locus_tag LOCUS_23100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249497.1 CDS 2428654..2430027 product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene hssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477338.1 CDS 2430190..2430633 product LytTR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977032.1 CDS 2430630..2431085 product DUF3021 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 CDS complement(2431151..2432629) product malate:quinone oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene mqo_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211366.1 CDS complement(2433010..2434608) product L-lactate permease transl_table 11 codon_start 1 locus_tag LOCUS_23150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960858.1 CDS 2434925..2436598 product CDP-glycerol glycerophosphotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_23160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595297.1 CDS complement(2436751..2437380) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827010.1 CDS complement(2437694..2438209) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907311.1 CDS 2438400..2439404 product Oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_23190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792518.1 CDS complement(2439450..2439851) product GCN5-related N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557510.1 CDS complement(2439887..2440921) product ferredoxin--NADP(+) reductase transl_table 11 codon_start 1 locus_tag LOCUS_23210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655971.1 CDS complement(2441153..2441584) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_23220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253464.1 CDS complement(2441791..2443068) product phage infection protein transl_table 11 codon_start 1 locus_tag LOCUS_23230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020016.1 CDS 2443229..2443852 product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656771.1 CDS 2443898..2444842 product magnesium transporter CorA transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene cobI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633068.1 CDS complement(2444928..2446049) product PTS sucrose transporter subunit IIBC transl_table 11 codon_start 1 locus_tag LOCUS_23260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108116.1 note frameshifted, insertion/deletion at around 2446161 CDS complement(2446156..2446371) product PTS system sucrose-specific IIBC component transl_table 11 codon_start 1 locus_tag LOCUS_23270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2446161 CDS 2446555..2446938 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664359.1 CDS 2448426..2450531 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128366.1 CDS 2450602..2451024 product Putative_PNPOx domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071904.1 CDS 2451289..2451645 product DUF4889 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727328.1 CDS complement(2452049..2453326) product Proton/sodium-glutamate symport protein transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene gltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173165.1 CDS complement(2453508..2453873) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727537.1 CDS 2454271..2454717 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289215.1 CDS 2454939..2455361 product Hsp20/alpha crystallin family protein transl_table 11 codon_start 1 locus_tag LOCUS_23350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797427.1 CDS complement(2455468..2456637) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_23360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278556.1 CDS 2457007..2457645 product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_23370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2457715..2457921 product DUF2268 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2457900..2458640 product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332063.1 CDS complement(2458898..2459551) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene nreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 CDS complement(2459574..2460608) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene nreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606546.1 CDS complement(2460632..2461084) product GAF domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186933.1 CDS complement(2461104..2461781) product nitrate reductase subunit gamma transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene narI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 CDS complement(2461774..2462349) product nitrate reductase molybdenum cofactor assembly chaperone transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene narJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795300.1 CDS complement(2462342..2463901) product nitrate reductase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene narH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692648.1 CDS complement(2463891..2467580) product nitrate reductase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_23460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514408.1 CDS complement(2467889..2468866) product Uroporphyrinogen-III C-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109877.1 CDS complement(2468857..2469171) product nitrite reductase (NAD(P)H) small subunit transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene nirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448224.1 CDS complement(2469175..2471580) product nitrite reductase large subunit transl_table 11 codon_start 1 locus_tag LOCUS_23490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118725.1 CDS complement(2471646..2472377) product cobalamin biosynthesis protein CbiX transl_table 11 codon_start 1 locus_tag LOCUS_23500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014063.1 CDS complement(2472607..2473143) product N-acetyltransferase domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169317.1 CDS complement(2473376..2474200) product formate/nitrite transporter transl_table 11 codon_start 1 locus_tag LOCUS_23520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572038.1 CDS complement(2474417..2474599) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230292.1 CDS complement(2474683..2475150) product glutathione S-transferase transl_table 11 codon_start 1 locus_tag LOCUS_23540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153347.1 CDS complement(2475336..2476886) product Zn-binding lipoprotein adcA-like protein transl_table 11 codon_start 1 locus_tag LOCUS_23550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727772.1 CDS complement(2477181..2477447) product Txe/YoeB family addiction module toxin transl_table 11 codon_start 1 locus_tag LOCUS_23560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 CDS complement(2477447..2477698) product prevent-host-death protein transl_table 11 codon_start 1 locus_tag LOCUS_23570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584499.1 CDS complement(2477971..2478570) product protein disulfide-isomerase transl_table 11 codon_start 1 locus_tag LOCUS_23580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162810.1 CDS complement(2478589..2478951) product cystatin-like fold lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_23590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819843.1 CDS 2479206..2480456 product aminoacyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene fmhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012225.1 CDS complement(2480553..2481284) product amino acid ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615461.1 CDS complement(2481281..2482000) product amino acid ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_23620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479576.1 CDS complement(2481981..2482760) product amino acid ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825921.1 CDS complement(2482881..2484320) product Transport system protein transl_table 11 codon_start 1 locus_tag LOCUS_23640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072416042.1 CDS complement(2484752..2485438) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene gpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125208.1 CDS complement(2485765..2486631) product cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_23660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019127.1 CDS 2487383..2488693 product immunoglobulin-binding protein sbi transl_table 11 codon_start 1 locus_tag LOCUS_23670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792559.1 CDS complement(2488633..2488812) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031763544.1 CDS 2489193..2490158 product Gamma-hemolysin component A transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene hlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594519.1 CDS 2490726..2491673 product gamma-hemolysin component C transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene hlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916704.1 CDS 2491675..2492652 product gamma-hemolysin component B transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene hlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783428.1 CDS complement(2492704..2493171) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200956.1 CDS complement(2493182..2493874) product 6-carboxyhexanoate--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene bioW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286875.1 CDS complement(2493885..2495000) product 8-amino-7-oxononanoate synthase transl_table 11 codon_start 1 locus_tag LOCUS_23740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971550.1 CDS complement(2494978..2495985) product biotin synthase transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene bioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046645.1 CDS complement(2495987..2497345) product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene bioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110061.1 CDS complement(2497323..2498009) product dethiobiotin synthase transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene bioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217926.1 CDS complement(2498461..2500194) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486487.1 CDS complement(2500219..2501982) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064825.1 CDS complement(2502851..2503237) product GtrA family protein transl_table 11 codon_start 1 locus_tag LOCUS_23800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779360.1 CDS 2503505..2504647 product glycerate kinase transl_table 11 codon_start 1 locus_tag LOCUS_23810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176863.1 CDS 2504707..2505366 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_23820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831298.1 CDS 2505548..2506759 product Bcr/CflA family drug resistance efflux transporter transl_table 11 codon_start 1 locus_tag LOCUS_23830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192075.1 CDS complement(2506882..2507355) product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456486.1 CDS 2507468..2508124 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080281.1 CDS complement(2508187..2508993) product phosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_23860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690200.1 CDS 2509280..2510689 product alanine glycine permease transl_table 11 codon_start 1 locus_tag LOCUS_23870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101538.1 CDS 2510827..2512905 product Putative Na+/H+ antiporter transl_table 11 codon_start 1 locus_tag LOCUS_23880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185695.1 CDS complement(2513045..2514874) product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_23890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483052.1 CDS 2515106..2516602 product Penicillin-binding protein PbpX transl_table 11 codon_start 1 locus_tag LOCUS_23900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208563.1 CDS complement(2516694..2517545) product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_23910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034497.1 CDS complement(2517867..2518802) product 2-dehydropantoate 2-reductase transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene panE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684060.1 CDS complement(2519028..2520428) product Putative drug transporter transl_table 11 codon_start 1 locus_tag LOCUS_23930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381269.1 CDS complement(2520722..2521417) product amino acid ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene opuCd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398941.1 CDS complement(2521417..2522358) product amino acid transporter transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene opuCc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721551.1 CDS complement(2522375..2523010) product choline ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene opuCb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569120.1 CDS complement(2523007..2524233) product glycine/betaine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948974.1 CDS complement(2524903..2525502) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291519.1 CDS complement(2525495..2525695) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071621408.1 CDS 2525682..2527319 product amino acid:proton symporter transl_table 11 codon_start 1 locus_tag LOCUS_24000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030720.1 CDS 2527927..2529279 product Carboxylic ester hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene pnbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700925.1 CDS complement(2529341..2530528) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_24020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026189.1 CDS complement(2530924..2531700) product iron export ABC transporter permease subunit FetB transl_table 11 codon_start 1 locus_tag LOCUS_24030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072149.1 CDS complement(2531693..2532355) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923526.1 CDS complement(2532603..2533679) product peptidase M28 transl_table 11 codon_start 1 locus_tag LOCUS_24050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 CDS complement(2534034..2534300) product Txe/YoeB family addiction module toxin transl_table 11 codon_start 1 locus_tag LOCUS_24060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074049.1 CDS complement(2534300..2534557) product prevent-host-death protein transl_table 11 codon_start 1 locus_tag LOCUS_24070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 CDS complement(2534663..2534857) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2534916..2535371 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732076.1 CDS complement(2535539..2537116) product FMN-binding glutamate synthase family protein transl_table 11 codon_start 1 locus_tag LOCUS_24100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143494.1 CDS 2537311..2538060 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072461.1 CDS complement(2538284..2539477) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_24120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675401.1 CDS complement(2539489..2540238) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598772.1 CDS complement(2540231..2541046) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 CDS complement(2541043..2541912) product nickel ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_24150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584759.1 CDS complement(2541909..2542844) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_24160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472243.1 CDS complement(2542857..2544455) product Nickel ABC transporter, nickel/metallophore periplasmic binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene nikA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229087.1 CDS complement(2544598..2545899) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040588.1 CDS complement(2545892..2546710) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058848.1 CDS complement(2546721..2547542) product diaminopimelate epimerase transl_table 11 codon_start 1 locus_tag LOCUS_24200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081693.1 CDS complement(2548409..2548774) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2549037..2549756) product short-chain dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene lvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824948.1 CDS 2550088..2551626 product transporter transl_table 11 codon_start 1 locus_tag LOCUS_24230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202034.1 CDS complement(2551738..2552160) product carboxymuconolactone decarboxylase family protein transl_table 11 codon_start 1 locus_tag LOCUS_24240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146763.1 CDS complement(2552612..2553031) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034766.1 CDS complement(2553049..2553468) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038240.1 CDS complement(2553735..2554157) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034758.1 CDS complement(2554408..2555103) product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_24280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217456.1 CDS 2555392..2555673 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220938.1 CDS 2555609..2555794 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791851.1 CDS complement(2555933..2556124) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224379.1 CDS complement(2556685..2557479) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_24320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581894.1 CDS complement(2558015..2558302) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521959.1 CDS complement(2558305..2558631) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495498.1 CDS complement(2558631..2558912) product Insertion sequenceATP-binding protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_24350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2558926 CDS complement(2558843..2559955) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044255.1 note frameshifted, insertion/deletion at around 2558923 CDS complement(2559952..2560662) product Putative lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_24370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581894.1 CDS complement(2560849..2561550) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_24380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972657.1 CDS complement(2561928..2564789) product helicase transl_table 11 codon_start 1 locus_tag LOCUS_24390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109589.1 CDS complement(2564791..2565183) product (deoxy)nucleoside triphosphate pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_24400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755946.1 CDS 2565471..2567108 product Phosphoglucomutase/phosphomannomutase family protein transl_table 11 codon_start 1 locus_tag LOCUS_24410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835549.1 CDS 2567392..2567658 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678764.1 CDS 2567802..2568110 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217714.1 CDS complement(2568218..2568388) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2568432..2569625) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_24450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353352.1 CDS complement(2570009..2574892) product Surface protein G transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene sasG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQD9 CDS complement(2575197..2575553) product Staphylococcal accessory regulator T transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene sarT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069993647.1 CDS 2575879..2576622 product Staphylococcal accessory regulator-like protein (SarU/SarH2) transl_table 11 codon_start 1 locus_tag LOCUS_24480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386367.1 CDS complement(2576833..2577699) product UTP--glucose-1-phosphate uridylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene gtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721336.1 CDS complement(2577879..2580701) product fibronectin-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene fnbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841404.1 CDS complement(2581383..2584439) product Fibronectin-binding protein A transl_table 11 codon_start 1 locus_tag LOCUS_24510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794614.1 CDS complement(2584573..2584875) product Fibronectin-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2584907..2586265) product gluconate permease transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene gntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481425.1 CDS complement(2586382..2587935) product gluconate kinase transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene gntK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876638.1 CDS complement(2587959..2588639) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene gntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990133.1 CDS complement(2588793..2589557) product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_24560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074011.1 CDS complement(2589722..2590414) product GTP pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_24570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289136.1 CDS complement(2590645..2591061) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117049.1 CDS complement(2591200..2591958) product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_24590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2592013 CDS complement(2591843..2593024) product FUSC family protein transl_table 11 codon_start 1 locus_tag LOCUS_24600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2592013 CDS complement(2593502..2594707) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_24610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 CDS 2595326..2595937 product DedA family protein transl_table 11 codon_start 1 locus_tag LOCUS_24620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435046.1 CDS complement(2596034..2597197) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_24630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34307 CDS complement(2597190..2597654) product Transcriptional regulator, MarR family transl_table 11 codon_start 1 locus_tag LOCUS_24640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2598082..2598777 product lantibiotic ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538625.1 CDS 2598779..2599549 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_24660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536961.1 CDS 2599922..2601886 product fructose 1,6-bisphosphatase transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene fbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192172.1 CDS 2601899..2602111 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2602230..2603309 product Putative membrane spanning protein transl_table 11 codon_start 1 locus_tag LOCUS_24690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443661.1 CDS complement(2603414..2604007) product carboxylesterase transl_table 11 codon_start 1 locus_tag LOCUS_24700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400021.1 CDS complement(2604029..2604997) product ring-cleaving dioxygenase transl_table 11 codon_start 1 locus_tag LOCUS_24710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609346.1 CDS complement(2605075..2605509) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_24720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376235.1 CDS 2605736..2606020 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_24730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067116.1 CDS 2606191..2606997 product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_24740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863968.1 CDS complement(2607117..2607788) product NAD(P)H-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_24750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069098.1 CDS 2608058..2609050 product lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene ddh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161545.1 CDS complement(2609299..2610099) product Cof-like hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_24770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237528.1 CDS 2610420..2611055 product peptide ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773921.1 CDS 2611070..2611792 product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_24790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801924.1 CDS complement(2611952..2612572) product class A sortase SrtA transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene srtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759366.1 CDS 2612766..2613257 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_24810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617356.1 CDS complement(2613695..2613865) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549802.1 CDS complement(2614044..2614943) product L-serine dehydratase, iron-sulfur-dependent subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene sdaAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460421.1 CDS complement(2614957..2615637) product L-serine dehydratase, iron-sulfur-dependent subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene sdaAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140234.1 CDS complement(2615640..2616683) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_24850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822491.1 CDS 2617234..2617437 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177186.1 CDS 2617629..2618555 product EamA family transporter transl_table 11 codon_start 1 locus_tag LOCUS_24870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072362001.1 CDS complement(2618637..2619605) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_24880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228167.1 CDS complement(2619738..2620082) product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_24890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240663.1 CDS complement(2620124..2620534) product acyl-CoA thioester hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_24900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206031.1 CDS complement(2620914..2622980) product PTS glucoside EIICBA component transl_table 11 codon_start 1 locus_tag LOCUS_24910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473678.1 CDS complement(2623281..2625020) product pyruvate oxidase transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene cidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062663.1 CDS complement(2625067..2625756) product holin-like protein CidB transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene cidB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001019.1 CDS complement(2625749..2626144) product holin-like protein CidA transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene cidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549734.1 CDS complement(2626357..2627235) product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_24950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549809.1 CDS 2627402..2627620 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011687.1 CDS 2628010..2628441 product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_24970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455861.1 CDS complement(2629201..2629458) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2630037..2631314) product hydroxymethylglutaryl-CoA reductase, degradative transl_table 11 codon_start 1 locus_tag LOCUS_24990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190998.1 CDS 2631568..2632734 product hydroxymethylglutaryl-CoA synthase transl_table 11 codon_start 1 locus_tag LOCUS_25000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 CDS complement(2632904..2633425) product methylated-DNA--[protein]-cysteine S-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_25010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455988.1 CDS 2633834..2635939 product ATP-dependent protease ATP-binding subunit ClpL transl_table 11 codon_start 1 locus_tag LOCUS_25020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058993.1 CDS complement(2636008..2636178) product FeoB-associated Cys-rich membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_25030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111117.1 CDS complement(2636191..2638185) product ferrous iron transporter B transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene feoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432915.1 CDS complement(2638197..2638424) product ferrous iron transporter A transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene feoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932073.1 CDS complement(2638640..2641129) product MmpL efflux pump transl_table 11 codon_start 1 locus_tag LOCUS_25060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835496.1 CDS 2641274..2641822 product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665238.1 CDS complement(2642178..2643722) product L-glutamate gamma-semialdehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259692.1 CDS complement(2643912..2644511) product maltose O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_25090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136487.1 CDS 2644750..2644941 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221404.1 CDS 2645181..2647589 product copper-exporting P-type ATPase A transl_table 11 codon_start 1 locus_tag LOCUS_25110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 CDS 2647869..2648075 product copper chaperone CopZ transl_table 11 codon_start 1 locus_tag LOCUS_25120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 CDS complement(2648165..2649163) product lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161369.1 CDS complement(2649186..2650340) product N-succinyldiaminopimelate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_25140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625061.1 CDS complement(2650767..2652275) product dehydrosqualene desaturase transl_table 11 codon_start 1 locus_tag LOCUS_25150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686168.1 CDS complement(2652287..2653150) product dehydrosqualene synthase transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene crtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178308.1 CDS complement(2653187..2654314) product 4,4'-diaponeurosporenoate glycosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_25170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871744.1 CDS complement(2654320..2655813) product diapolycopene oxygenase transl_table 11 codon_start 1 locus_tag LOCUS_25180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 CDS complement(2655806..2656303) product Glycosyl-4,4'-diaponeurosporenoate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_25190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 CDS complement(2656469..2657236) product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_25200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725225.1 CDS complement(2657597..2659408) product O-acetyltransferase OatA transl_table 11 codon_start 1 locus_tag LOCUS_25210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379821.1 CDS complement(2659920..2660408) product N-acetyltransferase domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_25220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996739.1 CDS complement(2660684..2661385) product transglycosylase IsaA transl_table 11 codon_start 1 locus_tag LOCUS_25230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751263.1 CDS complement(2661993..2663048) product PTS transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_25240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200684.1 CDS 2663458..2664027 product HTH tetR-type domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_25250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 CDS 2664405..2664725 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2664945..2665175 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697134.1 CDS complement(2665325..2665702) product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_25280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616225.1 CDS complement(2665719..2666540) product NmrA/HSCARG family protein transl_table 11 codon_start 1 locus_tag LOCUS_25290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651837.1 CDS complement(2666560..2666859) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055856.1 CDS 2666990..2667547 product TetR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224187.1 CDS 2667540..2668244 product short-chain dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 CDS 2668342..2669352 product Amidohydro-rel domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_25330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836421.1 CDS 2669372..2670202 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_25340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448918.1 CDS complement(2670349..2671239) product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_25350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706515.1 CDS complement(2671337..2671798) product Ferrous iron transporter B (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_25360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2671863 CDS complement(2671852..2672676) product ferrous iron transporter B transl_table 11 codon_start 1 locus_tag LOCUS_25370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2671863 CDS complement(2672670..2673776) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163746.1 CDS complement(2674110..2674406) product type II secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_25390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447709.1 CDS complement(2674394..2674762) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066369.1 CDS complement(2674777..2675052) product Type VII secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_25410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020977619.1 CDS complement(2675397..2676263) product fructosamine kinase family protein transl_table 11 codon_start 1 locus_tag LOCUS_25420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005523.1 CDS 2676481..2677545 product dihydroorotate dehydrogenase (quinone) transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene pyrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277419.1 CDS 2677700..2677975 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159839.1 CDS complement(2678161..2678883) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene queH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606210.1 CDS 2679237..2679686 product VOC family protein transl_table 11 codon_start 1 locus_tag LOCUS_25460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125705.1 CDS complement(2679767..2680354) product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151110.1 CDS 2680487..2682169 product Hydrolase, CocE/NonD family transl_table 11 codon_start 1 locus_tag LOCUS_25480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071595.1 CDS complement(2682298..2682681) product Aspartate 1-decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene panD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789904.1 CDS complement(2682683..2683534) product Pantothenate synthetase transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene panC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163737.1 CDS complement(2683527..2684345) product 3-methyl-2-oxobutanoate hydroxymethyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene panB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860047.1 CDS 2684418..2685278 product 2-dehydropantoate 2-reductase transl_table 11 codon_start 1 locus_tag LOCUS_25520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953572.1 CDS complement(2685364..2686068) product Alpha-acetolactate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene budA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186117.1 CDS complement(2686346..2687305) product L-lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846636.1 CDS 2687992..2689440 product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_25550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534425.1 CDS complement(2689521..2690858) product aspartate aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_25560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030072.1 CDS 2691116..2691532 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237629.1 CDS 2691655..2692545 product class I fructose-bisphosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene fda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031409.1 CDS complement(2692738..2694234) product malate:quinone oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene mqo_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130051.1 CDS 2694530..2694859 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791980.1 CDS complement(2694919..2696517) product acetyl-CoA synthetase transl_table 11 codon_start 1 locus_tag LOCUS_25610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172341.1 CDS complement(2696711..2697154) product antibiotic biosynthesis monooxygenase transl_table 11 codon_start 1 locus_tag LOCUS_25620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028775.1 CDS complement(2697435..2697647) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011688.1 CDS complement(2697925..2699634) product oxygen-dependent choline dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066521.1 CDS complement(2699895..2701385) product betaine-aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene betB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421713.1 CDS 2701638..2702201 product HTH-type transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198598.1 CDS complement(2702389..2703075) product MBL fold hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_25670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2703339..2704961) product choline transporter BetT transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene bccT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711870.1 CDS complement(2705480..2706016) product anaerobic ribonucleoside-triphosphate reductase activating protein transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene nrdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173331.1 CDS complement(2706013..2707863) product anaerobic ribonucleoside-triphosphate reductase transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene nrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071729.1 CDS complement(2708110..2709480) product citrate transporter transl_table 11 codon_start 1 locus_tag LOCUS_25710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 CDS complement(2709973..2710578) product precorrin-2 dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_25720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057052.1 CDS complement(2710641..2712521) product Sulfite reductase (NADPH) flavoprotein alpha-component, putative transl_table 11 codon_start 1 locus_tag LOCUS_25730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775150.1 CDS complement(2712916..2713413) product glutathione peroxidase transl_table 11 codon_start 1 locus_tag LOCUS_25740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065268.1 CDS complement(2713423..2713674) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791974.1 CDS complement(2714837..2716837) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_25760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776751.1 CDS complement(2716834..2717589) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_25770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923760.1 CDS complement(2717697..2718584) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_25780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143425.1 CDS complement(2718595..2719260) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_25790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697877.1 CDS complement(2719286..2719486) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604730.1 CDS 2719684..2721108 product alkaline phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene phoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953755.1 CDS complement(2721391..2721846) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106185.1 CDS complement(2722091..2722852) product esterase family protein transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene estA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323441.1 CDS complement(2722968..2725601) product Clumping factor B transl_table 11 codon_start 1 locus_tag LOCUS_25840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2725951..2726655) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene arcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138218.1 CDS complement(2726754..2727695) product carbamate kinase 2 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene arcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660028.1 CDS complement(2727712..2729142) product arginine-ornithine antiporter transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene arcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005835.1 CDS complement(2729233..2730243) product ornithine carbamoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene arcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136162.1 CDS complement(2730276..2731511) product arginine deiminase transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene arcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129417.1 CDS complement(2731858..2732307) product ArgR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene argR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748760.1 CDS complement(2732674..2734203) product peptidase M4 family protein transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene aur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001821522.1 CDS complement(2734627..2735154) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044560.1 CDS 2735412..2735870 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_25930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734801.1 CDS 2736110..2737984 product PTS mannose transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_25940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887022.1 CDS 2738061..2740013 product EIIA transl_table 11 codon_start 1 locus_tag LOCUS_25950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706111.1 CDS 2740027..2740965 product mannose-6-phosphate isomerase, class I transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene manA_3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173201.1 CDS complement(2741077..2744058) product phage infection protein transl_table 11 codon_start 1 locus_tag LOCUS_25970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786115.1 CDS 2744269..2746128 product N-acetylmuramoyl-L-alanine amidase transl_table 11 codon_start 1 locus_tag LOCUS_25980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125628.1 CDS complement(2746395..2746955) product cysteine hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_25990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 CDS complement(2747123..2749030) product Putative surface anchored protein transl_table 11 codon_start 1 locus_tag LOCUS_26000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151890.1 CDS complement(2749272..2750630) product accessory Sec system glycosylation chaperone GtfB transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene gtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593156.1 CDS complement(2750623..2752131) product accessory Sec system glycosyltransferase GtfA transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene gtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158423.1 CDS complement(2752149..2754539) product accessory Sec system translocase SecA2 transl_table 11 codon_start 1 locus_tag LOCUS_26030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680945.1 CDS complement(2754529..2755488) product Accessory secretory protein Asp3 transl_table 11 codon_start 1 locus_tag LOCUS_26040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916728.1 CDS complement(2755466..2757034) product Accessory secretory protein Asp2 transl_table 11 codon_start 1 locus_tag LOCUS_26050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137481.1 CDS complement(2757024..2758577) product accessory Sec system protein Asp1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873204.1 CDS complement(2758588..2759799) product accessory Sec system protein translocase subunit SecY2 transl_table 11 codon_start 1 locus_tag LOCUS_26070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916127.1 CDS complement(2759929..2760300) product LPXTG cell wall anchor domain-containing protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_26080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2760281..2761045 product LPXTG cell wall anchor domain-containing protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_26090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2760296 note possible pseudo due to internal stop codon CDS 2761169..2762377 product Serine-rich adhesin for platelets transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene sraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2762657..2763457 product LPXTG cell wall anchor domain-containing protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_26110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2763635..2763913 product Serine-rich repeat glycoprotein adhesin SasA (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_26120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2763923..2764447 product Serine-rich repeat glycoprotein adhesin SasA (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene sasA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 2764487..2764729 product Serine-rich repeat glycoprotein adhesin SasA (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene sasA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2767289..2767981) product flavin reductase transl_table 11 codon_start 1 locus_tag LOCUS_26150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 CDS 2768247..2768675 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549854.1 CDS 2768662..2768964 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260044.1 CDS 2769118..2769477 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603479.1 CDS complement(2769562..2770173) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287924.1 CDS complement(2770252..2770728) product methionine sulfoxide reductase A transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene msrA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261962.1 CDS complement(2770731..2771231) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_26210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244277.1 CDS complement(2771466..2772233) product capsular polysaccharide biosynthesis protein Cap8C transl_table 11 codon_start 1 locus_tag LOCUS_26220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565310.1 CDS complement(2772230..2772922) product capsular polysaccharide biosynthesis protein Cap5B transl_table 11 codon_start 1 locus_tag LOCUS_26230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185863.1 CDS complement(2772939..2773601) product capsular polysaccharide biosynthesis protein CapA transl_table 11 codon_start 1 locus_tag LOCUS_26240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659683.1 CDS complement(2774450..2775010) product biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene tetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653261.1 CDS 2775300..2776412 product poly-beta-1,6 N-acetyl-D-glucosamine synthase transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene icaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 CDS 2776376..2776681 product poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene icaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240580.1 CDS 2776678..2777550 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_26280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877369.1 CDS 2777537..2778589 product poly-beta-1,6-N-acetyl-D-glucosamine export protein transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene icaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723836.1 CDS complement(2779036..2781081) product Triacylglycerol lipase transl_table 11 codon_start 1 locus_tag LOCUS_26300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842040.1 CDS complement(2781799..2782011) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2782171..2783559) product Histidine biosynthesis bifunctional protein HisIE transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene hisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(2783556..2784260) product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene hisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571742.1 CDS complement(2784253..2784831) product imidazole glycerol phosphate synthase subunit HisH transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene hisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635623.1 CDS complement(2784828..2785406) product imidazoleglycerol-phosphate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene hisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640266.1 CDS complement(2785375..2786388) product histidinol-phosphate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene hisC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639184.1 CDS complement(2786404..2787660) product Histidinol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene hisD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930649.1 CDS complement(2787647..2788261) product ATP phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene hisG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944149.1 CDS complement(2788279..2789097) product ATP phosphoribosyltransferase regulatory subunit transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene hisZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065591.1 CDS complement(2789402..2790526) product polysaccharide deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_26400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549222.1 CDS complement(2790644..2791141) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_26410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610973.1 CDS complement(2791188..2792021) product energy-coupling factor transporter transmembrane protein EcfT transl_table 11 codon_start 1 locus_tag LOCUS_26420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077823.1 CDS complement(2792018..2793730) product ABC transporter, ATP-binding protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_26430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138654.1 CDS complement(2793783..2794337) product DUF3816 family protein transl_table 11 codon_start 1 locus_tag LOCUS_26440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743711.1 CDS complement(2794366..2795214) product DNA-directed RNA polymerase subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_26450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 CDS 2795594..2796109 product polyisoprenoid-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_26460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181124.1 CDS complement(2796258..2797229) product lactonase transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene drp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082559.1 CDS 2797473..2798429 product sulfurtransferase transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene trhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109281.1 CDS 2798581..2799219 product pyrrolidone-carboxylate peptidase transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene pcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547838.1 CDS complement(2799338..2800105) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956429.1 CDS complement(2800095..2800433) product PadR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_26510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116416.1 CDS 2800600..2801064 product DinB family protein transl_table 11 codon_start 1 locus_tag LOCUS_26520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208909.1 CDS 2801302..2802720 product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_26530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432352.1 CDS complement(2803133..2804041) product protein RarD transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene rarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019815.1 CDS 2804266..2804841 product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_26550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174573.1 CDS 2805006..2806022 product nickel transporter NixA transl_table 11 codon_start 1 locus_tag LOCUS_26560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 CDS 2806265..2807059 product arylamine N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_26570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017423.1 CDS complement(2807193..2807705) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_26580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410764.1 CDS 2807988..2808746 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_26590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154162.1 CDS 2808736..2810616 product Putative hemin transport system permease protein HrtB transl_table 11 codon_start 1 locus_tag LOCUS_26600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143647.1 CDS 2810709..2810900 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene vraH_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672033.1 CDS 2811038..2811448 product Mobile element protein transl_table 11 codon_start 1 locus_tag LOCUS_26620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2811418 CDS complement(2811508..2812005) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2812084..2812434 product IS30 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_26640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 2812463..2812654 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene vraH_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672033.1 CDS 2813047..2813247 product cold-shock protein transl_table 11 codon_start 1 locus_tag LOCUS_26660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059079.1 CDS complement(2813374..2813943) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_26670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054128.1 CDS complement(2814203..2814598) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779134.1 CDS complement(2814666..2815019) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491382.1 CDS 2815207..2815356 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_26700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617169.1 CDS complement(2815473..2816312) product nucleoid occlusion protein transl_table 11 codon_start 1 locus_tag LOCUS_26710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742837.1 CDS complement(2816355..2817074) product ribosomal RNA small subunit methyltransferase G transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene gidB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215587.1 CDS complement(2817074..2818951) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene mnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249657.1 CDS complement(2819018..2820397) product tRNA modification GTPase TrmE transl_table 11 codon_start 1 locus_tag LOCUS_26740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362509.1 CDS complement(2820536..2820883) product ribonuclease P protein component transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene rnpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789343.1 CDS complement(2821010..2821147) product 50S ribosomal protein L34 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator