COMMON DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST https://dfast.ddbj.nig.ac.jp/ ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..623390 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(157..408) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956747.1 CDS complement(1153..1338) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006110.1 CDS complement(2577..2783) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002340.1 CDS complement(3077..3289) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795785.1 CDS complement(3990..4187) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793526.1 CDS complement(4680..6020) product glutamine synthetase transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene glnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 CDS complement(6039..6407) product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene glnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624945.1 CDS complement(6650..7888) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme transl_table 11 codon_start 1 locus_tag LOCUS_00080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 CDS complement(7907..9145) product GTPase HflX transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene hflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068617.1 CDS 9257..9733 product glutathione peroxidase transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene bsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448078.1 CDS complement(9955..10188) product RNA-binding protein Hfq transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561358.1 CDS complement(10203..11138) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene miaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548613.1 CDS complement(11156..12070) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_00130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136952.1 CDS complement(12220..13893) product aerobic glycerol-3-phosphate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene glpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 CDS complement(14051..15547) product glycerol kinase transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene glpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417372.1 CDS complement(15676..16494) product aquaporin family protein transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene glpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 CDS complement(16959..17492) product glycerol-3-phosphate responsive antiterminator transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene glpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077635.1 CDS complement(17507..19516) product DNA mismatch repair protein MutL transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene mutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516269.1 CDS complement(19529..22147) product DNA mismatch repair protein MutS transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene mutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073352.1 CDS complement(22450..22941) product energy coupling factor transporter S component ThiW transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene thiW_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842277.1 CDS complement(22968..23333) product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene ymcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282386.1 CDS complement(23334..24878) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene miaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001524.1 CDS complement(25012..25305) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655666.1 CDS complement(25399..26265) product 2-oxoglutarate ferredoxin oxidoreductase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene korB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190138.1 CDS complement(26266..28026) product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_00250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804320.1 CDS complement(28166..28963) product metallophosphoesterase transl_table 11 codon_start 1 locus_tag LOCUS_00260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222105.1 CDS 29137..29352 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026308.1 CDS complement(29649..31208) product ribonuclease Y transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rny inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050913.1 CDS complement(31562..32605) product DNA recombination/repair protein RecA transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene recA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368166.1 CDS complement(32770..33921) product competence protein CinA transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene cinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020347.1 CDS complement(34148..34726) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene pgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025093.1 CDS complement(34760..35152) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859443.1 CDS complement(35171..35998) product DUF3388 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_00330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214890.1 CDS complement(36103..36807) product 3-oxoacyl-ACP reductase transl_table 11 codon_start 1 locus_tag LOCUS_00340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646228.1 CDS complement(36807..38093) product Insulinase family protein transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene ymfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664775.1 CDS complement(38093..39358) product peptidase M16 transl_table 11 codon_start 1 locus_tag LOCUS_00360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089941.1 CDS complement(39389..40102) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_00370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293312.1 CDS complement(40107..42476) product DNA translocase FtsK transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene ftsK_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001811366.1 CDS complement(42732..44405) product ribonuclease J 2 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rnjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052590.1 CDS complement(44641..46737) product polyribonucleotide nucleotidyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene pnpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076690.1 CDS complement(47107..47376) product 30S ribosomal protein S15 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene rpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 CDS complement(47491..48462) product bifunctional riboflavin kinase/FMN adenylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene ribC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864185.1 CDS complement(48477..49394) product tRNA pseudouridine(55) synthase TruB transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene truB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282298.1 CDS complement(49563..49913) product ribosome-binding factor A transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 CDS complement(50299..52416) product translation initiation factor IF-2 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene infB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043635.1 CDS complement(52421..52738) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rplGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 CDS complement(52735..53019) product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_00470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727423.1 CDS complement(53040..54215) product transcription termination/antitermination protein NusA transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene nusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097460.1 CDS complement(54236..54703) product ribosome maturation factor transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene rimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036633.1 CDS complement(54993..59309) product DNA polymerase III subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene polC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801936.1 CDS complement(59567..61270) product proline--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene proS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814094.1 CDS complement(61290..62576) product RIP metalloprotease RseP transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene rasP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121119.1 CDS complement(62813..63595) product phosphatidate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene cdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868413.1 CDS complement(63602..64372) product isoprenyl transferase transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene uppS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 CDS complement(64745..65299) product ribosome-recycling factor transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene frr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280006.1 CDS complement(65318..66040) product uridylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene pyrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057330.1 CDS complement(66177..67058) product elongation factor Ts transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene tsf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 CDS complement(67240..68007) product 30S ribosomal protein S2 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268484.1 CDS complement(68349..69122) product GTP-sensing pleiotropic transcriptional regulator CodY transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene codY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055337.1 CDS complement(69147..70550) product HslU--HslV peptidase ATPase subunit transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene hslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379044.1 CDS complement(70616..71161) product HslU--HslV peptidase proteolytic subunit transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene hslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072681.1 CDS complement(71158..72054) product tyrosine recombinase XerC transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene xerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015601.1 CDS complement(72471..73778) product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene gid inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195254.1 CDS complement(73934..76003) product DNA topoisomerase I transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene topA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557331.1 CDS complement(76183..77055) product DNA-protecting protein DprA transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene dprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800825.1 CDS complement(77228..78472) product aminoacyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene fmhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672869.1 CDS complement(78500..79618) product cell wall hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene lytN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041666.1 CDS complement(79845..80753) product succinyl-CoA ligase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene sucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 CDS complement(80775..81941) product succinyl-CoA ligase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene sucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020801.1 CDS complement(82050..82817) product ribonuclease HII transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rnhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176393.1 CDS complement(82801..83685) product ribosome biogenesis GTPase YlqF transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236726.1 CDS 85334..86692 product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_00720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(86936..87286) product 50S ribosomal protein L19 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rplS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 CDS complement(87389..88126) product tRNA (guanosine(37)-N1)-methyltransferase TrmD transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene trmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 CDS complement(88126..88629) product ribosome maturation factor RimM transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 CDS complement(88817..89092) product 30S ribosomal protein S16 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene rpsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268754.1 CDS complement(89527..90894) product signal recognition particle protein transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene ffh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 CDS complement(90920..91252) product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_00780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531320.1 CDS complement(91239..92489) product signal recognition particle-docking protein FtsY transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene ftsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007678.1 CDS complement(92489..96055) product chromosome segregation protein SMC transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262698.1 CDS complement(96202..96933) product ribonuclease 3 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene rnc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043237.1 CDS complement(97049..97282) product acyl carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene acpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426914.1 CDS complement(97525..98259) product beta-ketoacyl-ACP reductase transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene fabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 CDS complement(98252..99178) product malonyl CoA-ACP transacylase transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene fabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047343.1 CDS complement(99171..100157) product phosphate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene plsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 CDS complement(100162..100719) product transcription factor transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene fapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548538.1 CDS complement(100937..102997) product DNA helicase RecG transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene recG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151509.1 CDS complement(103187..104833) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene fakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623903.1 CDS complement(104848..105222) product Asp23/Gls24 family envelope stress response protein transl_table 11 codon_start 1 locus_tag LOCUS_00890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 CDS 105665..105853 product 50S ribosomal protein L28 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene rpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517908.1 CDS complement(106234..106875) product thiamine pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene thiN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547910.1 CDS complement(106882..107526) product ribulose-phosphate 3-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene cfxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164332.1 CDS complement(107527..108402) product GTPase transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene rsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847936.1 CDS complement(108630..110624) product serine/threonine protein kinase Stk1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene pknB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579563.1 CDS complement(110621..111364) product protein phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 CDS complement(111371..112465) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 CDS complement(112468..113775) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572235.1 CDS complement(113772..114707) product methionyl-tRNA formyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene fmt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161291.1 CDS complement(114700..115188) product peptide deformylase transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene def2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985293.1 CDS 115487..115690 product TM2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_01000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(115853..116806) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751704.1 CDS complement(117312..119720) product primosomal protein N' transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene priA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560839.1 CDS complement(119720..120919) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene coaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 CDS complement(121135..121353) product DNA-directed RNA polymerase subunit omega transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene rpoZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933956.1 CDS complement(121353..121976) product guanylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene gmk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368226.1 CDS 122251..123948 product Rqc2 homolog RqcH transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312768.1 CDS complement(124211..124612) product VOC family protein transl_table 11 codon_start 1 locus_tag LOCUS_01070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354180.1 CDS complement(125049..125261) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998557.1 CDS complement(125291..125902) product orotate phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene pyrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040248.1 CDS complement(125902..126594) product orotidine-5'-phosphate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene pyrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654067.1 CDS complement(126704..129877) product carbamoyl-phosphate synthase large chain transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene carB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126259.1 CDS complement(129870..130970) product carbamoyl-phosphate synthase small chain transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene carA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190913.1 CDS complement(130972..132246) product dihydroorotase transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene pyrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767028.1 CDS complement(132264..133145) product aspartate carbamoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene pyrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016166.1 CDS complement(133173..134480) product uracil permease transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene pyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178619.1 CDS complement(134698..135225) product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene pyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003870.1 CDS complement(135625..136542) product RluA family pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_01170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451294.1 CDS complement(136542..137033) product lipoprotein signal peptidase transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene lspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 CDS 137587..137796 product Truncated transposase transl_table 11 codon_start 1 locus_tag LOCUS_01190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(137857..138654) product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_01200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274855.1 CDS complement(138694..138846) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(138944..141697) product isoleucine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene ileS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384691.1 CDS complement(141918..142535) product cell division protein DivIVA transl_table 11 codon_start 1 locus_tag LOCUS_01230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117064.1 CDS complement(142559..143365) product S4 RNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232511.1 CDS complement(143448..143738) product cell division protein transl_table 11 codon_start 1 locus_tag LOCUS_01250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354114.1 CDS complement(143750..144313) product cell division protein SepF transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene sepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018608.1 CDS complement(144310..144984) product YggS family pyridoxal phosphate enzyme transl_table 11 codon_start 1 locus_tag LOCUS_01270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548498.1 CDS complement(145002..145793) product peptidoglycan editing factor PgeF transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene pgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075111477.1 CDS complement(146053..147225) product cell division protein FtsZ transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene ftsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888997.1 CDS complement(147258..148670) product cell division protein FtsA transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene ftsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391031.1 CDS complement(148776..150095) product cell division protein DivIB transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene divIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342182.1 CDS complement(150111..151460) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene murD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935991.1 CDS complement(151462..152427) product phospho-N-acetylmuramoyl-pentapeptide-transferase transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene mraY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578458.1 CDS complement(152719..154953) product penicillin-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene pbp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118652.1 CDS complement(154934..155335) product cell division protein FtsL transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene ftsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257598.1 CDS complement(155349..156284) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene rsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468384.1 CDS complement(156300..156731) product division/cell wall cluster transcriptional repressor MraZ transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene mraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 CDS complement(156875..158236) product bacillithiol biosynthesis cysteine-adding enzyme BshC transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene bshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340465.1 note frameshifted, insertion/deletion at around 158289 CDS complement(158269..158496) product Bacillithiol biosynthesis cysteine-adding enzyme BshC transl_table 11 codon_start 1 locus_tag LOCUS_01390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 158289 CDS 158691..159131 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289711.1 CDS complement(159240..159926) product noncanonical pyrimidine nucleotidase, YjjG family transl_table 11 codon_start 1 locus_tag LOCUS_01410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788648.1 CDS complement(160059..160193) product hemolytic protein transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene psmβ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147103.1 CDS complement(160250..160384) product hemolytic protein transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene psmβ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398672.1 tRNA 160747..160822 product glyoxalase locus_tag LOCUS_t00010 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(161296..161484) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245796.1 CDS 161733..162680 product permease transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene eta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239282.1 CDS complement(162985..163212) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149423.1 CDS complement(163520..165076) product YfcC family protein transl_table 11 codon_start 1 locus_tag LOCUS_01470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078056048.1 CDS complement(165248..166180) product carbamate kinase 1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene arcC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074342.1 CDS complement(166203..167204) product ornithine carbamoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene argF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793607.1 CDS 167642..168367 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ssl14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739531.1 CDS 168462..169187 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene ssl13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063553.1 CDS 169295..170011 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene ssl12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041897.1 CDS complement(170455..170652) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802045.1 CDS 171455..172414 product alpha-hemolysin transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene hla inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857488.1 CDS 172891..173124 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231632.1 CDS 173746..173931 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032817.1 repeat_region 174149..174393 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccgccaacttgcacatt inference COORDINATES:alignment:CRT:1.2 CDS complement(174753..175103) product fibrinogen-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene scc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669537.1 CDS complement(175257..175754) product fibrinogen-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene efb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791581.1 CDS complement(176013..176519) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584398.1 CDS 177191..177592 product FPRL1 inhibitory protein transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene flr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739564.1 CDS complement(177696..177884) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(177961..178290) product fibrinogen-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene ecb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739210.1 CDS complement(178484..178651) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791787.1 CDS complement(178779..179282) product metallophosphoesterase transl_table 11 codon_start 1 locus_tag LOCUS_01640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049484.1 CDS complement(179275..179862) product non-canonical purine NTP pyrophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_01650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659319.1 CDS complement(179874..180674) product glutamate racemase transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene murI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039659.1 CDS complement(180910..181725) product succinate dehydrogenase iron-sulfur subunit transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene sdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 CDS complement(181725..183491) product succinate dehydrogenase flavoprotein subunit transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene sdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818278.1 CDS complement(183543..184157) product succinate dehydrogenase cytochrome B558 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene sdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079317.1 CDS complement(184481..186262) product excinuclease ABC subunit UvrC transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene uvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390524.1 CDS complement(186586..186900) product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene trxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 CDS complement(187073..189421) product endonuclease MutS2 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene mutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249275.1 CDS complement(189431..191143) product DNA polymerase/3'-5' exonuclease PolX transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene polX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161938.1 CDS complement(191216..191659) product CvpA family protein transl_table 11 codon_start 1 locus_tag LOCUS_01740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234068.1 CDS complement(191745..192005) product Cell division protein ZapA transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene zapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VI53 CDS 192375..193313 product ribonuclease HIII transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene rnhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284282.1 CDS complement(193484..195886) product phenylalanine--tRNA ligase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene pheT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908969.1 CDS complement(195886..196944) product phenylalanine--tRNA ligase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene pheS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003566.1 CDS complement(197325..198065) product RNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435374.1 CDS complement(198449..198772) product monooxygenase IsdI transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene isdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670950.1 CDS complement(198791..199525) product SrtB family sortase transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene srtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 CDS complement(199587..199790) product Iron-regulated surface determinant protein F transl_table 11 codon_start 1 locus_tag LOCUS_01820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 199795 CDS complement(199775..200551) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548422.1 note frameshifted, insertion/deletion at around 199795 CDS complement(200564..201442) product heme uptake system protein IsdE transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene isdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220199.1 CDS complement(201439..202515) product Heme ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene isdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246685.1 CDS complement(202515..203198) product heme uptake protein IsdC transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene isdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789821.1 CDS 203407..204459 product LPXTG-anchored heme-scavenging protein IsdA transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene isdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160859.1 CDS 204663..206600 product iron-regulated surface determinant protein B transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene isdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041583.1 CDS complement(206754..206927) product 50S ribosomal protein L32 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene rpmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290472.1 CDS complement(207007..207564) product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_01900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872158.1 CDS 207691..208830 product tRNA(Met) cytidine acetate ligase transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene tmcAL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843611.1 CDS complement(208892..209374) product phosphopantetheine adenylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene coaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 CDS complement(209376..209918) product methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene rsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263796.1 CDS 209988..210377 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_01940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814565.1 CDS complement(210380..210634) product YlbG family protein transl_table 11 codon_start 1 locus_tag LOCUS_01950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049150.1 CDS 210873..211799 product glycerophosphodiester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_01960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757575.1 CDS complement(211862..212296) product regulator transl_table 11 codon_start 1 locus_tag LOCUS_01970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606480.1 CDS complement(212312..213349) product CAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_01980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733409.1 CDS complement(213676..214137) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene ctaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 CDS complement(214162..215073) product protoheme IX farnesyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene ctaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031401.1 CDS 215513..216424 product heme A synthase transl_table 11 codon_start 1 locus_tag LOCUS_02010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557321.1 CDS complement(216564..220016) product pyruvate carboxylase transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene pycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809514.1 CDS complement(220570..221796) product cell division protein FtsW transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ftsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787940.1 CDS complement(222110..222385) product YlaN family protein transl_table 11 codon_start 1 locus_tag LOCUS_02040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118417.1 CDS 222526..223008 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614712.1 CDS 223010..223177 product DUF2197 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250275.1 CDS complement(223317..225164) product translational GTPase TypA transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene typA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182654.1 CDS 225266..225457 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810620.1 CDS complement(225611..226438) product inositol monophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene imp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240318.1 CDS 226595..227209 product DUF1054 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170603.1 CDS 227393..228250 product Manganese transporter mntH transl_table 11 codon_start 1 locus_tag LOCUS_02110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 228323..228745 product Manganese transport protein MntH transl_table 11 codon_start 1 locus_tag LOCUS_02120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(228827..229246) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_02130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080466.1 CDS complement(229529..230548) product DUF4064 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145499.1 CDS complement(230622..231695) product spermidine/putrescine ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene potD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819684.1 CDS complement(231695..232504) product spermidine/putrescine ABC transporter homolog transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene potC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872390.1 CDS complement(232510..233307) product spermidine/putrescine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene potB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246555.1 CDS complement(233300..234394) product spermidine/putrescine import ATP-binding protein PotA transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene potA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433551.1 CDS complement(234407..234946) product XRE family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_02190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020625.1 CDS complement(235090..235365) product UPF0223 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455597.1 CDS complement(235533..236939) product dihydrolipoamide dehydrogenase component of pyruvate dehydrogenase E3 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene pdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260117.1 CDS complement(236943..238235) product dihydrolipoamide S-acetyltransferase component of pyruvate dehydrogenase complex E2 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene pdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 CDS complement(238326..239303) product pyruvate dehydrogenase E1 component beta subunit transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene phdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068176.1 CDS complement(239307..240419) product pyruvate dehydrogenase E1 component subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene pdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035320.1 CDS complement(240590..241216) product cell-wall-binding lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_02250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668336.1 CDS 241581..242132 product peptide deformylase transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene def inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957037.1 CDS 242613..242831 product DNA-directed RNA polymerase subunit epsilon transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene rpoY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257888.1 CDS 242831..244528 product ribonuclease J 1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene rnjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811375.1 CDS complement(244877..245539) product potassium transporter Trk transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene ktrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 CDS complement(245672..246691) product cytochrome D ubiquinol oxidase subunit II transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene cydB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638459.1 CDS complement(246688..248049) product cytochrome ubiquinol oxidase subunit I transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene cydA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381849.1 CDS 248247..248480 product NrdH-redoxin transl_table 11 codon_start 1 locus_tag LOCUS_02320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289618.1 CDS complement(248717..250435) product phosphoenolpyruvate--protein phosphotransferase transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene ptsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040051.1 CDS complement(250438..250704) product phosphocarrier protein HPr transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene ptsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437472.1 CDS complement(250858..251400) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505966.1 CDS complement(251454..252626) product class I SAM-dependent rRNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685067.1 CDS complement(253051..254346) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009069.1 CDS 254498..254632 product Uncharacterized protein graF transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene graF inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 255216..255791 product thiamine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene thiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033477.1 CDS 255806..257206 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene thiW_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921965.1 CDS 257199..258005 product energy-coupling factor transporter transmembrane protein EcfT transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene thiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273253.1 CDS complement(258270..259517) product Phosphoribosylamine--glycine ligase transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene purD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101899.1 CDS complement(259539..261017) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene purH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709277.1 CDS complement(261032..261598) product phosphoribosylglycinamide formyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene purN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238669.1 CDS complement(261601..262629) product phosphoribosylformylglycinamidine cyclo-ligase transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene purM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030811.1 CDS complement(262622..264106) product amidophosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene purF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483720.1 CDS complement(264085..266274) product phosphoribosylformylglycinamidine synthase subunit PurL transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene purL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032740.1 CDS complement(266267..266938) product phosphoribosylformylglycinamidine synthase subunit PurQ transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene purQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666806.1 CDS complement(266940..267203) product phosphoribosylformylglycinamidine synthase PurS transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene purS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848350.1 CDS complement(267203..267907) product phosphoribosylaminoimidazolesuccinocarboxamide synthase transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene purC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174053.1 CDS complement(267911..269035) product 5-(carboxyamino)imidazole ribonucleotide synthase transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene purK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010413.1 CDS complement(269022..269504) product 5-(carboxyamino)imidazole ribonucleotide mutase transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene purE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072353889.1 CDS 269705..270565 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene folD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225836.1 CDS 271371..271688 product DUF5011 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037831.1 CDS 272260..273360 product cytochrome aa3 quinol oxidase subunit II transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene qoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032836.1 CDS 273360..275348 product cytochrome aa3 quinol oxidase subunit I transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene qoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010762.1 CDS 275338..275943 product quinol oxidase subunit 3 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene qoxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017736.1 CDS 275940..276230 product quinol oxidase subunit 4 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene qoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104254.1 CDS complement(276767..277960) product protein FmtA transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene fmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671245.1 CDS 278411..279628 product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase transl_table 11 codon_start 1 locus_tag LOCUS_02600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031978.1 CDS 279676..280146 product DUF2538 family protein transl_table 11 codon_start 1 locus_tag LOCUS_02610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088431.1 CDS 280301..280735 product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 CDS 280963..284733 product bifunctional autolysin transl_table 11 codon_start 1 locus_tag LOCUS_02630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074534.1 CDS complement(284940..285359) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_02640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278015.1 CDS 285512..286522 product acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202433.1 CDS 286718..287872 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme transl_table 11 codon_start 1 locus_tag LOCUS_02660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777577.1 CDS 288400..289410 product Glu-specific serine endopeptidase SspA transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene sspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676539.1 CDS 289492..290673 product staphopain B transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene sspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089094.1 CDS 290711..291040 product staphostatin B transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene sspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284458.1 CDS complement(291279..292100) product 1,4-dihydroxy-2-naphthoyl-CoA synthase transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene menB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184945.1 CDS complement(292093..292896) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene menH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150197.1 CDS complement(292883..294556) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene menD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526694.1 CDS complement(294543..295904) product isochorismate synthase transl_table 11 codon_start 1 locus_tag LOCUS_02730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001816819.1 CDS 296086..297024 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene menA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070966.1 CDS complement(297075..297626) product acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620949.1 CDS 297791..298006 product TM2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(298247..299206) product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081351.1 CDS 299694..300050 product DoxX family protein transl_table 11 codon_start 1 locus_tag LOCUS_02780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766009.1 CDS complement(300139..301620) product glycosyl transferase family 1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene tarM inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(301626..301913) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(302570..303211) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_02810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571167.1 CDS complement(303208..303528) product YxeA family protein transl_table 11 codon_start 1 locus_tag LOCUS_02820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668627.1 CDS complement(303531..305495) product bacteriocin-associated integral membrane family protein transl_table 11 codon_start 1 locus_tag LOCUS_02830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870829.1 CDS complement(306839..307441) product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_02840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033865.1 CDS complement(307456..307632) product DUF2187 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214898.1 CDS 307831..308817 product lipoate--protein ligase A transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene lplA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668818.1 CDS complement(308898..309116) product IDEAL domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876826.1 CDS 309326..309895 product competence protein ComK transl_table 11 codon_start 1 locus_tag LOCUS_02880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287265.1 tRNA 310037..310111 product tRNA-Asn locus_tag LOCUS_t00020 gene trnaN_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 310113..310203 product tRNA-Ser locus_tag LOCUS_t00030 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(310382..311896) product bifunctional metallophosphatase/5'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_02890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414165.1 CDS complement(312032..313390) product Ktr system potassium uptake protein D transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene ktrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021865.1 CDS complement(313407..315716) product serine protease transl_table 11 codon_start 1 locus_tag LOCUS_02910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795272.1 CDS complement(315950..316753) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_02920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928413.1 CDS complement(317055..318617) product peptide chain release factor 3 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene prfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049950.1 CDS complement(318617..318868) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795833.1 CDS complement(318861..320342) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene murE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340119.1 CDS 320775..321950 product diacylglycerol beta-glucosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene ugtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258645.1 CDS complement(322032..322295) product MFS transporter (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_02970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 322261..323118 product MFS domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_02980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(323231..323740) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_02990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600387.1 CDS complement(323934..324692) product esterase family protein transl_table 11 codon_start 1 locus_tag LOCUS_03000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288675.1 CDS complement(324834..326402) product alanine:cation symporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_03010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570687.1 CDS 326744..327829 product AI-2E family transporter transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene cozEa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933105.1 CDS complement(328024..328794) product enoyl-ACP reductase FabI transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene fabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933195.1 CDS complement(329072..330916) product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene cpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395153.1 CDS complement(330926..332311) product magnesium transporter transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene mgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 CDS complement(332332..333186) product RNA pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_03060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669923.1 CDS complement(333183..333992) product NAD(+) kinase transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene ppnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270834.1 CDS complement(334009..334644) product GTP pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene relQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077683.1 CDS complement(334661..335008) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242103.1 CDS 335194..335787 product adenylate cyclase transl_table 11 codon_start 1 locus_tag LOCUS_03100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224619.1 CDS 335891..336256 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene yjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214070.1 CDS 336279..337085 product DsbA family protein transl_table 11 codon_start 1 locus_tag LOCUS_03120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896697.1 CDS complement(337545..339353) product oligoendopeptidase F transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene pepF_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082725.1 CDS complement(339401..340387) product competence protein CoiA transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene trfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959282.1 CDS complement(340508..341227) product adaptor protein MecA transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene mecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217728.1 CDS complement(341598..341993) product regulatory protein Spx transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene spxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258003.1 CDS 342288..343277 product tryptophan--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene trpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448934.1 CDS complement(343319..344200) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene opp-4C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180280.1 CDS complement(344212..345174) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene opp-4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915997.1 CDS complement(345167..346147) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene opp-4F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427767.1 CDS complement(346150..347136) product peptide ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene opp-4D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067052.1 CDS complement(347187..348902) product oligopeptide ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517183.1 CDS complement(349114..350769) product peptide ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene opp-3A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197018.1 CDS complement(350788..351729) product oligopeptide transport system ATP-binding protein OppF transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene oppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786734.1 CDS complement(351719..352801) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene opp-3D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140050.1 CDS complement(352818..353888) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene opp-3C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829632.1 CDS complement(353888..354814) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene opp-3B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521533.1 CDS 355057..355428 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_03280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915157.1 CDS complement(355483..356727) product beta-ketoacyl-[acyl-carrier-protein] synthase II transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene fabF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081231.1 CDS complement(356739..357680) product 3-oxoacyl-ACP synthase III transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene fabH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100526.1 CDS 357975..358160 product DUF2929 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_03310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682089.1 CDS complement(358417..358851) product MAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_03320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769694.1 CDS complement(359162..359677) product phosphatidylethanolamine-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700882.1 CDS complement(359661..360779) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_03340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037440.1 CDS complement(360772..361413) product L-threonylcarbamoyladenylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_03350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404422.1 CDS complement(361397..362542) product 2-isopropylmalate synthase transl_table 11 codon_start 1 locus_tag LOCUS_03360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619360.1 CDS 362652..363521 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_03370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047069.1 CDS complement(363580..366189) product ATP-dependent chaperone ClpB transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene clpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353954.1 CDS complement(366392..368206) product O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_03390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044230.1 CDS complement(368753..369061) product DNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene sufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390575.1 CDS 369175..369999 product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_03410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182436.1 CDS 370051..371367 product CoA-disulfide reductase transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene cdr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124506.1 CDS complement(371538..371927) product YisL family protein transl_table 11 codon_start 1 locus_tag LOCUS_03430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902805.1 CDS complement(372256..373158) product fumarylacetoacetate hydrolase family protein transl_table 11 codon_start 1 locus_tag LOCUS_03440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670752.1 CDS complement(373324..376977) product ATP-dependent helicase/nuclease subunit A transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene addA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154921.1 CDS complement(376978..380454) product helicase-exonuclease AddAB subunit AddB transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene addB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172350.1 CDS complement(380614..381189) product signal peptidase IB transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene spsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711896.1 CDS complement(381205..381729) product inactive signal peptidase IA transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene spsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758209.1 CDS complement(381734..382309) product TVP38/TMEM64 family protein transl_table 11 codon_start 1 locus_tag LOCUS_03490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007967.1 CDS complement(382634..383965) product glucose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene pgi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148852.1 CDS 384316..385521 product argininosuccinate synthase transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene argG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660045.1 CDS 385511..386890 product argininosuccinate lyase transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene argH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066053.1 CDS 387132..388061 product glycerophosphodiester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene glpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185319.1 repeat_region 388131..388413 rpt_family CRISPR rpt_type direct rpt_unit_seq ccaacttgcacactattgtaagctgacttt inference COORDINATES:alignment:CRT:1.2 CDS complement(388564..389808) product NAD-specific glutamate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene gudB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138487.1 CDS complement(389917..391107) product Ornithine aminotransferase 2 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rocD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 CDS complement(391415..392542) product NADH-dependent flavin oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_03560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838029.1 CDS complement(392904..393281) product general stress protein transl_table 11 codon_start 1 locus_tag LOCUS_03570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067294.1 CDS complement(393697..394290) product peptidyl-prolyl cis-trans isomerase transl_table 11 codon_start 1 locus_tag LOCUS_03580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035058.1 CDS 394354..394737 product kinase transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene kapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781162.1 CDS 394868..397273 product Na+/H+ antiporter subunit A transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene mnhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054612.1 CDS 397266..397694 product Na+/H+ antiporter subunit B transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene mnhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081626.1 CDS 397694..398035 product Na(+)/H(+) antiporter subunit C transl_table 11 codon_start 1 locus_tag LOCUS_03620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443624.1 CDS 398028..399524 product Na(+)/H(+) antiporter subunit D transl_table 11 codon_start 1 locus_tag LOCUS_03630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573077.1 CDS 399526..400005 product Na+/H+ antiporter subunit E transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene mnhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290674.1 CDS 400005..400298 product Na+/H+ antiporter subunit F transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene mnhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016306.1 CDS 400276..400632 product Na+/H+ antiporter subunit G transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene mnhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590451.1 CDS 400881..402035 product pyridine nucleotide-disulfide oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_03670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 CDS complement(402091..402465) product thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_03680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149295.1 CDS complement(402484..403800) product Na+/H+ antiporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_03690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606324.1 CDS complement(404211..405686) product cytosol aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene pepZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009692.1 CDS complement(405817..407025) product NADH dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ndh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046076.1 CDS complement(407479..407838) product iron-sulfur cluster assembly accessory protein transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene sufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 CDS complement(407851..408087) product YuzB family protein transl_table 11 codon_start 1 locus_tag LOCUS_03730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068337.1 CDS 408404..409468 product NADH dehydrogenase family protein transl_table 11 codon_start 1 locus_tag LOCUS_03740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794020.1 CDS complement(409527..409850) product disulfide oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_03750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401414.1 CDS 409951..410193 product NifU family protein transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene nfu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141883.1 CDS complement(410456..411631) product D-alanyl-lipoteichoic acid biosynthesis protein DltD transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene dltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769415.1 CDS complement(411628..411864) product D-alanine--poly(phosphoribitol) ligase subunit 2 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene dltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395692.1 CDS complement(411882..413096) product D-alanyl-lipoteichoic acid biosynthesis protein DltB transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene dltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613541.1 CDS complement(413093..414550) product D-alanine--poly(phosphoribitol) ligase transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene dltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129659.1 CDS complement(414566..414718) product teichoic acid D-Ala incorporation-associated protein DltX transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene dltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837752.1 CDS complement(415130..416089) product D-glycerate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_03820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239131.1 CDS complement(416122..416901) product TIGR01457 family HAD-type hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene nagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816184.1 CDS complement(416901..417335) product DUF86 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_03840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273982.1 CDS 417433..417699 product DUF3055 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_03850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566649.1 CDS complement(417778..418161) product YutD family protein transl_table 11 codon_start 1 locus_tag LOCUS_03860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598444.1 CDS complement(418291..419208) product lipoyl synthase transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene lipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201875.1 CDS complement(419292..420611) product bifunctional metallophosphatase/5'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_03880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241246.1 CDS complement(420638..421465) product sulfite exporter TauE/SafE family protein transl_table 11 codon_start 1 locus_tag LOCUS_03890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 CDS complement(421478..422326) product DUF72 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_03900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608129.1 CDS complement(422539..423606) product nitronate monooxygenase transl_table 11 codon_start 1 locus_tag LOCUS_03910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267236.1 CDS complement(423620..424660) product HlyC/CorC family transporter transl_table 11 codon_start 1 locus_tag LOCUS_03920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582326.1 CDS 425025..425339 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_03930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274029.1 CDS complement(425669..427066) product Fe-S cluster assembly protein SufB transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene sufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 CDS complement(427217..427681) product iron-sulfur cluster assembly scaffold protein NifU transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene sufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010508.1 CDS complement(427671..428912) product aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene sufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006450.1 CDS complement(429027..430334) product Fe-S cluster assembly protein SufD transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene sufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205567.1 CDS complement(430432..431193) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene sufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168845.1 CDS 431521..432372 product DUF368 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_03990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 CDS complement(432605..432799) product CsbD family protein transl_table 11 codon_start 1 locus_tag LOCUS_04000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752917.1 CDS complement(433153..433974) product methionine ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene metQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732324.1 CDS complement(433992..434687) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene metP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520231.1 CDS complement(434680..435705) product methionine import ATP-binding protein MetN 2 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene metN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571207.1 CDS complement(435955..436251) product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_04040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065801.1 CDS complement(436244..436630) product topiosmerase transl_table 11 codon_start 1 locus_tag LOCUS_04050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018962.1 CDS complement(437372..438250) product DUF1963 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932225.1 CDS complement(438429..438809) product glycine cleavage system protein H transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene gcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 CDS complement(438967..439323) product arsenate reductase transl_table 11 codon_start 1 locus_tag LOCUS_04080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589549.1 CDS 439467..439787 product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_04090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147952.1 CDS complement(439937..440476) product nitroreductase transl_table 11 codon_start 1 locus_tag LOCUS_04100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422908.1 CDS complement(440559..441275) product 3-dehydroquinase transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene aroD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150011.1 CDS 441423..441845 product organic hydroperoxide reductase OsmC/OhrA transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene ohr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974460.1 CDS 442244..442738 product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569884.1 CDS 442893..443510 product amino acid transporter transl_table 11 codon_start 1 locus_tag LOCUS_04140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255551.1 CDS complement(443583..444164) product histidine phosphatase family protein transl_table 11 codon_start 1 locus_tag LOCUS_04150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802951.1 CDS 444389..444625 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349581.1 CDS complement(444622..444825) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145163.1 CDS 445166..445426 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059690.1 CDS 445455..445643 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052076.1 CDS 445831..446400 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene lnsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106654.1 CDS 446488..446772 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004399.1 CDS 446834..447052 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005886.1 CDS complement(447548..447748) product cold-shock protein transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene cspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059082.1 CDS complement(448105..448791) product thermonuclease transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene nuc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141557.1 CDS complement(449132..449602) product Extracellular matrix and plasma binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene vwb_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824482.1 CDS complement(449937..450959) product extracellular matrix protein-binding adhesin Emp transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene emp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728068.1 CDS complement(451310..452719) product coagulase transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene vwb_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791702.1 CDS complement(452716..452835) product Truncated secreted von Willebrand factor-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 452721 CDS complement(453056..455839) product Clumping factor A transl_table 11 codon_start 1 locus_tag LOCUS_04290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(456102..456632) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167158.1 CDS complement(456771..457292) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608192.1 CDS 457891..458619 product DUF5067 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757397.1 CDS 458811..458957 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057759.1 CDS 458973..459296 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058299.1 tmRNA complement(460169..460527) product transfer-messenger RNA locus_tag LOCUS_tm00010 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(460618..461082) product SsrA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene smpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 CDS complement(461104..463476) product ribonuclease R transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene rnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050048.1 CDS complement(463510..464250) product carboxylesterase transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene est inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165959.1 CDS complement(464366..464599) product protein-export membrane protein SecG transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene secG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 CDS complement(464666..465124) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785252.1 CDS complement(465464..466768) product enolase transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene eno inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121760.1 CDS complement(466898..468415) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene pgm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085507.1 CDS complement(468418..469179) product triose-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene tpi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260089.1 CDS complement(469301..470491) product phosphoglycerate kinase transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pgk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074749.1 CDS complement(470630..471640) product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene gapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279414.1 CDS complement(471693..472706) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene gapR_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654030.1 CDS complement(473348..473977) product DUF4887 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070831.1 CDS 474680..475582 product epimerase transl_table 11 codon_start 1 locus_tag LOCUS_04470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816304.1 CDS complement(475825..476412) product ATP-dependent Clp protease proteolytic subunit transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene clpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 tRNA 476599..476671 product transcriptional regulator locus_tag LOCUS_t00040 gene gapR_2 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(476985..477929) product sporulation regulator WhiA transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene whiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006551.1 CDS complement(478039..479034) product YvcK family protein transl_table 11 codon_start 1 locus_tag LOCUS_04500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248939.1 CDS complement(479031..479942) product RNase adapter RapZ transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369722.1 CDS complement(480936..481871) product thioredoxin reductase transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene trxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134963.1 CDS complement(481938..483377) product tetratricopeptide repeat protein transl_table 11 codon_start 1 locus_tag LOCUS_04530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057543.1 CDS complement(483385..483870) product acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_04540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224793.1 CDS complement(483878..484717) product prolipoprotein diacylglyceryl transferase transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene lgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 CDS complement(484723..485655) product HPr kinase/phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene hprK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958224.1 CDS complement(486317..489163) product excinuclease ABC subunit A transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene uvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662676.1 CDS complement(489171..491156) product excinuclease ABC subunit B transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene uvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 CDS complement(491425..491661) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene csbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638419.1 CDS complement(491658..492308) product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538141.1 CDS complement(492482..493321) product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_04610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753319.1 CDS complement(493730..494722) product Peptide chain release factor 2 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene prfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967760.1 CDS complement(495155..497686) product preprotein translocase subunit SecA transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene secA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506531.1 CDS complement(498100..498672) product ribosome-associated translation inhibitor RaiA transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene raiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617735.1 CDS complement(498733..499407) product competence protein ComF transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene comFC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057965.1 CDS complement(499400..500482) product comf operon protein 1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene comFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557172.1 CDS complement(500846..501229) product 6-phosphogluconate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_04670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 501373..502014 product YigZ family protein transl_table 11 codon_start 1 locus_tag LOCUS_04680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192949.1 CDS complement(502184..503239) product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene tagO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 CDS 503557..504627 product GGDEF domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene gdpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460983.1 CDS 504823..505584 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_04710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113406.1 CDS 505602..506096 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_04720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899890.1 CDS 506110..507336 product peptidase T transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene pepT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795811.1 CDS complement(507525..508649) product glycerate kinase transl_table 11 codon_start 1 locus_tag LOCUS_04740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866737.1 CDS complement(509074..509394) product bacillithiol system redox-active protein YtxJ transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene ytxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 CDS complement(509548..510426) product EMYY motif lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_04760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724887.1 CDS 510546..511064 product GrpB family protein transl_table 11 codon_start 1 locus_tag LOCUS_04770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287207.1 CDS 511191..512114 product UDP-N-acetylenolpyruvoylglucosamine reductase transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene murB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608433.1 CDS 512132..512446 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127269.1 CDS complement(512763..513791) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene sstD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754443.1 CDS complement(513910..514671) product iron ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene sstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616840.1 CDS complement(514668..515624) product iron chelate uptake ABC transporter family permease subunit transl_table 11 codon_start 1 locus_tag LOCUS_04820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245577.1 CDS complement(515611..516582) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene sstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876318.1 CDS complement(517290..518261) product ribonucleotide-diphosphate reductase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene nrdF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562498.1 CDS complement(518379..520484) product ribonucleotide-diphosphate reductase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene nrdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855514.1 CDS complement(520447..520845) product protein NrdI transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene nrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692521.1 CDS 521646..522512 product EamA/RhaT family transporter transl_table 11 codon_start 1 locus_tag LOCUS_04870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068501.1 CDS 522532..523032 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene queF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930014.1 CDS 523373..524878 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene dtpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193751.1 CDS 525148..526065 product lipid kinase transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene bmrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429006.1 CDS complement(526689..527231) product 5'-3'-deoxyribonucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_04910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 CDS complement(527582..528640) product histidinol-phosphate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene hisC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663030.1 CDS complement(528880..530394) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene opuBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180991.1 CDS complement(530387..531364) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_04940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589248.1 CDS complement(531586..533367) product DNA helicase RecQ transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene recQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983677.1 CDS complement(533379..535256) product ABC-F family ATP-binding cassette domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_04960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525106.1 CDS complement(535533..537473) product lipoteichoic acid synthase transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene ltaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098285.1 CDS complement(537947..538951) product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022323.1 CDS complement(538935..539645) product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_04990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708690.1 CDS complement(539733..539939) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797134.1 CDS complement(540005..540613) product aminodeoxychorismate lyase transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene pabC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175781.1 CDS complement(540613..541764) product para-aminobenzoate synthetase subunit I transl_table 11 codon_start 1 locus_tag LOCUS_05020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217796.1 CDS complement(541748..542341) product aminodeoxychorismate/anthranilate synthase component II transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene pabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604514.1 CDS 542692..543360 product 7-cyano-7-deazaguanine synthase QueC transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene queC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446724.1 CDS 543362..543781 product 6-carboxytetrahydropterin synthase QueD transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene queD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941336.1 CDS 543785..544498 product 7-carboxy-7-deazaguanine synthase QueE transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene queE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062972.1 CDS 544597..545181 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604990.1 CDS 545461..545901 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene saeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093562.1 CDS 546243..546716 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene saeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037807.1 CDS 546691..547377 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene saeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149344.1 CDS 547377..548432 product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene saeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244415.1 CDS complement(548504..549487) product glycosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene csbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702778.1 CDS complement(549619..550458) product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_05130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931238.1 CDS complement(550680..552029) product HlyC/CorC family transporter transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene mpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450257.1 CDS complement(552250..553431) product N-acetylglucosamine-6-phosphate deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene nagA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 CDS complement(553739..555697) product PTS fructose transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene fruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266553.1 CDS complement(555703..556623) product 1-phosphofructokinase transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene fruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640737.1 CDS complement(556620..557381) product DeoR/GlpR transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557168.1 CDS complement(557634..558116) product Cys-tRNA(Pro) deacylase transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene ybaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107235.1 CDS complement(558290..558742) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216725.1 CDS complement(559035..560201) product multidrug efflux MFS transporter NorA transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene norA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041274.1 CDS 560410..560832 product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776018.1 CDS 561015..561635 product DUF1361 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191874.1 CDS 561632..561916 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(562071..563444) product deoxyribodipyrimidine photo-lyase transl_table 11 codon_start 1 locus_tag LOCUS_05250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952038.1 CDS complement(563530..565083) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288051.1 CDS complement(565366..565653) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180416.1 CDS complement(565688..566596) product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_05280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435109.1 CDS complement(566699..567625) product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794419.1 CDS 567852..568295 product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene mgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283444.1 CDS complement(568422..570095) product cysteine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene cydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857598.1 CDS complement(570092..571723) product cysteine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene cydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737160.1 CDS 571942..572817 product Undecaprenyl-diphosphatase transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene uppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469894.1 CDS 572989..573672 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358498.1 CDS 573675..574133 product DUF188 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148826.1 CDS 574135..574701 product Rossman fold protein, TIGR00730 family transl_table 11 codon_start 1 locus_tag LOCUS_05360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820897.1 CDS complement(574797..575339) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638613.1 CDS complement(575419..575718) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545115.1 CDS complement(575856..576251) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733432.1 CDS complement(576318..576761) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259672.1 CDS 576888..577577 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842860.1 CDS complement(577676..578164) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152582.1 CDS complement(578161..579381) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_05430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367062.1 CDS complement(579582..580448) product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene ccpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687412.1 CDS complement(580564..581208) product DUF402 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_05450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865624.1 CDS complement(581561..582034) product cupin transl_table 11 codon_start 1 locus_tag LOCUS_05460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833486.1 CDS complement(582034..582750) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532966.1 CDS complement(582940..583299) product HTH-type transcriptional regulator SarX transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene sarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074490.1 CDS complement(583445..585595) product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rbf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129749.1 CDS complement(586292..586936) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081602.1 CDS 587297..588094 product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_05510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731644.1 CDS complement(588682..589689) product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene pitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120368.1 CDS complement(589705..590322) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene pitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491755.1 CDS complement(591047..592936) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene vraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143615.1 CDS complement(592926..593687) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene vraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985996.1 CDS complement(593831..594871) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene graS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061264.1 CDS complement(594864..595538) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene graR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166500.1 CDS complement(595554..596477) product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene graX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802955.1 CDS 596590..597096 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940129.1 CDS complement(597305..597733) product Decarboxylase family protein transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene yvdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198504.1 CDS complement(598062..599105) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_05610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030772.1 CDS complement(599256..600323) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980137.1 CDS complement(600779..601276) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164085.1 CDS complement(601392..601754) product PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene dhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124167.1 CDS complement(601747..602331) product dihydroxyacetone kinase subunit L transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene dhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867201.1 CDS complement(602373..603341) product dihydroxyacetone kinase subunit DhaK transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene dhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976269.1 CDS complement(603575..604591) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene fhuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625878.1 CDS complement(604588..605592) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene fhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184741.1 CDS complement(605628..606425) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene fhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080809.1 CDS complement(606707..607540) product YitT family protein transl_table 11 codon_start 1 locus_tag LOCUS_05700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044662.1 CDS complement(608065..609294) product nucleoside permease transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene nupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479279.1 CDS complement(609653..611380) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene abcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817954.1 CDS 611801..613096 product D-alanyl-D-alanine carboxypeptidase transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene pbp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793067.1 CDS complement(613213..613611) product glycerol-3-phosphate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene tagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832260.1 CDS complement(613674..614735) product glycosyl transferase transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene tagX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241182.1 CDS complement(614732..615835) product teichoic acid biosynthesis protein B transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene tagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101602.1 CDS complement(615934..616746) product teichoic acid ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene tagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273058.1 CDS 617093..617887 product teichoic acids export ATP-binding protein TagH transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene tagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103231.1 CDS complement(617948..618712) product N-acetylmannosaminyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene tagA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215388.1 CDS 618948..619700 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_05800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108547.1 CDS complement(619780..620424) product DtxR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene mntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954654.1 CDS 620546..621289 product metal ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894464.1 CDS 621283..622119 product metal ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene mntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889252.1 CDS 622116..623054 product metal ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_05840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737654.1 sequence02 source 1..106668 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(487..840) product Putative fluoride ion transporter CrcB transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene crcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623470.1 CDS complement(837..1202) product camphor resistance protein CrcB transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene crcB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200542.1 CDS complement(1458..1760) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091442.1 CDS 2020..2733 product transaldolase transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene tal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096495.1 CDS complement(3173..3808) product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene spdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168903.1 CDS 4104..4547 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030469.1 CDS complement(4534..4977) product competence protein ComK transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene comK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153742.1 CDS complement(5090..5560) product RNA polymerase sigma factor SigS transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene sigS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671057.1 CDS 5759..5983 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_05930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384171.1 CDS 6259..7113 product autolysin transl_table 11 codon_start 1 locus_tag LOCUS_05940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032833.1 CDS complement(7408..7803) product protein ArsC transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene arsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358995.1 CDS complement(7821..9113) product arsenite efflux transporter membrane subunit ArsB transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene arsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989121.1 CDS complement(9113..9427) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene arsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221177.1 CDS 9950..11452 product pyridine nucleotide-disulfide oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_05980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261668.1 CDS 11933..12976 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene ribD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384185.1 CDS 12983..13615 product riboflavin synthase transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene ribB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493887.1 CDS 13626..14807 product riboflavin biosynthesis protein RibBA transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene ribA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159037.1 CDS 14820..15284 product 6,7-dimethyl-8-ribityllumazine synthase transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene ribH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008549.1 CDS complement(15406..16407) product proline dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene putA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196362.1 CDS 16641..17468 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266096.1 CDS 17815..18306 product IS5/IS1182 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_06050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 18280,17866,17838 CDS 18303..18527 product Mobile element protein transl_table 11 codon_start 1 locus_tag LOCUS_06060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 18279 CDS 19047..19448 product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_06070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757543.1 CDS complement(19568..20131) product rRNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_06080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764419.1 CDS complement(20128..21081) product TIGR01212 family radical SAM protein transl_table 11 codon_start 1 locus_tag LOCUS_06090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526539.1 CDS 21230..22372 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_06100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025067.1 CDS 22663..25077 product leucine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene leuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 CDS 25099..25410 product rhodanese-like domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836461.1 CDS 25753..32313 product LPXTG-anchored repetitive surface protein SasC transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene sasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050566.1 CDS complement(32430..33698) product aminoacetone oxidase family FAD-binding enzyme transl_table 11 codon_start 1 locus_tag LOCUS_06140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285020.1 CDS 34105..35766 product polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_06150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004335.1 CDS 35763..36458 product 16S rRNA pseudouridine(516) synthase transl_table 11 codon_start 1 locus_tag LOCUS_06160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217125.1 CDS 36475..36897 product YtxH domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051856.1 repeat_region 37204..37412 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttggggcccttaccccaacttgcacattattga inference COORDINATES:alignment:CRT:1.2 CDS 37761..39170 product Mn(2+)-dependent dipeptidase Sapep transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene sapep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265417.1 CDS 39174..40022 product D-alanine aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene dat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411084.1 CDS 40572..41363 product phosphotransferase transl_table 11 codon_start 1 locus_tag LOCUS_06200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434765.1 CDS 41378..42022 product tRNA (guanosine(46)-N7)-methyltransferase TrmB transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene trmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266161.1 CDS 42543..43334 product MBL fold metallo-hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689582.1 CDS complement(43459..43770) product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_06230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163826.1 CDS 43857..44933 product glutamyl aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_06240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024576.1 CDS 44998..45309 product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_06250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811163.1 CDS 45409..46266 product DUF1444 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091387.1 CDS 46295..46891 product tRNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048368.1 CDS 46912..50736 product DNA translocase FtsK transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ftsK_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118314.1 CDS 50760..52073 product UDP-N-acetylmuramate--L-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene murC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150169.1 CDS 52147..52638 product DUF948 domain containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383814.1 CDS 52712..54229 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193903.1 CDS 54929..56020 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene aroA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066378.1 CDS 56560..57549 product catabolite control protein A transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ccpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219066.1 CDS complement(57647..58816) product acetoin utilization protein AcuC transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene acuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184011.1 CDS complement(58841..59473) product Acetoin utilization protein AcuA transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene acuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016004.1 CDS 59642..61348 product acetate--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene acsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 CDS 61788..63455 product Formate--tetrahydrofolate ligase transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene fhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 CDS 63789..66476 product haptoglobin-binding heme uptake protein HarA transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene harA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032804.1 CDS complement(66679..67584) product penicillin-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene sgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184370.1 CDS 67966..69228 product tyrosine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene tyrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 CDS complement(69322..70596) product serine protease transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene htrA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279338.1 CDS 70768..71385 product 1-acyl-sn-glycerol-3-phosphate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene plsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287588.1 CDS 71513..72979 product PTS glucose transporter subunit IIBC transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene ptaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276367.1 CDS 73086..74216 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721699.1 CDS complement(74366..75970) product D-3-phosphoglycerate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene serA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808849.1 CDS complement(75957..77117) product alanine--glyoxylate aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_06460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291420.1 CDS complement(77231..77677) product peroxiredoxin transl_table 11 codon_start 1 locus_tag LOCUS_06470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553924.1 CDS 77757..78500 product glycerophosphoryl diester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_06480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174284.1 CDS complement(78716..79318) product 30S ribosomal protein S4 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene rpsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090512.1 CDS complement(79562..80026) product GAF domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207852.1 CDS 80163..81857 product septation ring formation regulator EzrA transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene ezrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244866.1 CDS 82229..83368 product cysteine desulfurase transl_table 11 codon_start 1 locus_tag LOCUS_06520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840521.1 CDS 83368..84591 product tRNA 4-thiouridine(8) synthase ThiI transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene thiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872662.1 CDS 84635..85405 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_06540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365312.1 CDS 85503..85997 product 2-Cys peroxiredoxin transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene tpx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136260.1 CDS 86120..87067 product class I SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_06560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840576.1 CDS 87155..88357 product acetate kinase transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene ackA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040063.1 CDS complement(88603..89103) product universal stress protein UspA transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene uspA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 CDS 89244..90362 product alanine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene ald2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690007.1 CDS complement(90678..91733) product dipeptidase transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene pepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161666.1 CDS 91908..92597 product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_06610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777188.1 CDS complement(92902..93315) product universal stress protein transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene uspA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277602.1 CDS 93520..94818 product CBS domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160435.1 CDS 95079..96020 product bifunctional oligoribonuclease/PAP phosphatase NrnA transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene pde2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626082.1 CDS 96041..99238 product DNA polymerase III subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene dnaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226919.1 CDS 99688..100917 product NAD-dependent malic enzyme 4 transl_table 11 codon_start 1 locus_tag LOCUS_06660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058389.1 CDS 101112..101969 product acetyl-CoA carboxylase carboxyltransferase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene accD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471571.1 CDS 101969..102913 product acetyl-CoA carboxylase carboxyl transferase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene accA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883648.1 CDS 103182..104150 product ATP-dependent 6-phosphofructokinase transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene pfkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717561.1 CDS 104172..105929 product pyruvate kinase transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene pykA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232648.1 sequence03 source 1..82260 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 450..1511 product PTS transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_06710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063580.1 CDS 1769..3226 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene glnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 CDS 3213..3941 product amino acid ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene glnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 CDS 4092..5219 product epoxyqueuosine reductase transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene queG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793998.1 CDS 5224..5694 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene cspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181394.1 CDS 5853..6452 product glucosamine-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_06760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251224.1 CDS 6477..6629 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031108.1 CDS 7406..7801 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_06780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901023.1 CDS 7997..9382 product class II fumarate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene fumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116228.1 CDS complement(9845..10666) product RNA pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_06800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669376.1 CDS 10829..11941 product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene airS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437969.1 CDS 11963..12586 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene airR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 CDS 12942..13406 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_06830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375864.1 CDS 13585..14709 product DUF445 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992518.1 CDS 14778..15122 product YlbF/YmcA family competence regulator transl_table 11 codon_start 1 locus_tag LOCUS_06850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290301.1 CDS 15894..17090 product DNA repair exonuclease transl_table 11 codon_start 1 locus_tag LOCUS_06860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238227.1 CDS 17080..20016 product DNA double-strand break repair Rad50 ATPase transl_table 11 codon_start 1 locus_tag LOCUS_06870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584628.1 CDS 20013..20954 product 3'-5' exoribonuclease YhaM transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene cbf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244175.1 CDS complement(21075..22037) product foldase transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene prsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782121.1 CDS complement(22242..22799) product DUF3267 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477959.1 CDS complement(23532..23897) product YtxH domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_06910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648118.1 CDS complement(24039..24461) product HIT family protein transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene hit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 CDS 24595..25335 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene ecsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216874.1 CDS 25328..26551 product multidrug ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_06940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551836.1 CDS complement(26675..27178) product signal transduction protein TRAP transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene traP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737976.1 CDS 27444..28478 product uroporphyrinogen decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene hemE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233526.1 CDS 28536..29459 product ferrochelatase transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene hemH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162881.1 CDS 29483..30883 product protoporphyrinogen oxidase transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene hemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167542.1 CDS 31206..31760 product Hydrolase YdeN transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene ydeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132890.1 tRNA 32232..32305 product tRNA-Met locus_tag LOCUS_t00050 gene trnaM_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32327..32402 product tRNA-Asp locus_tag LOCUS_t00060 gene trnaD_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32419..32491 product tRNA-Phe locus_tag LOCUS_t00070 gene trnaF_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32505..32580 product tRNA-His locus_tag LOCUS_t00080 gene trnaH_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32596..32669 product tRNA-Gly locus_tag LOCUS_t00090 gene trnaG_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32684..32758 product tRNA-Asn locus_tag LOCUS_t00100 gene trnaN_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32759..32832 product tRNA-Glu locus_tag LOCUS_t00110 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 32886..32974 product tRNA-Asp locus_tag LOCUS_t00120 gene trnaD_2 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(34217..35005) product DUF1828 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206343.1 CDS complement(35018..35527) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 36371..37291 product gamma-hemolysin subunit A transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene lukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473596.1 CDS 37293..38276 product leucotoxin LukDv transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene lukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782463.1 CDS 38518..38661 product lantibiotic epidermin transl_table 11 codon_start 1 locus_tag LOCUS_07040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 39398..39541 product lantibiotic epidermin transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene epiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 39606..42599 product Lantibiotic epidermin biosynthesis protein EpiB transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene epiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 CDS 42592..43836 product Lantibiotic epidermin biosynthesis protein EpiC transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene epiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 43852..44370 product enterotoxin transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene epiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 44380..45753 product peptidase S8 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene epiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 45776..46468 product bacitracin ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene epiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254089.1 CDS complement(46827..47171) product Lantibiotic epidermin immunity protein F transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene epiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 47223..47921 product Lantibiotic epidermin immunity protein F transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene epiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(48395..48961) product DUF4888 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092780.1 CDS 49925..50632 product serine protease SplA transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene splA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039427.1 CDS 50757..51479 product serine protease SplB transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene splB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039454.1 CDS 51537..52256 product serine protease SplC transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene splC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038872.1 CDS 52377..53096 product serine protease SplD transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene splD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038704.1 CDS 53254..53970 product serine protease SplE transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene splE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038752.1 CDS 54121..54840 product serine protease SplF transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene splF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038752.1 assembly_gap 55688..55830 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 55856..56704 product Site-specific DNA-methyltransferase (adenine-specific) transl_table 11 codon_start 1 locus_tag LOCUS_07200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 56697..57896 product restriction endonuclease subunit S transl_table 11 codon_start 1 locus_tag LOCUS_07210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072627.1 CDS 58746..62858 product NTPase transl_table 11 codon_start 1 locus_tag LOCUS_07220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 63378..63755 product Exported protein transl_table 11 codon_start 1 locus_tag LOCUS_07230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 64625..64768 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_07240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 64777 note possible pseudo due to internal stop codon CDS 64971..65180 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_07250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 65372..65755 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 65766..65942 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 65944..66129 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 66243..66884 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 66989..67174 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(67102..67653) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414216.1 CDS complement(67751..68095) product DUF3969 family protein transl_table 11 codon_start 1 locus_tag LOCUS_07320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627540.1 CDS complement(68136..68762) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669024.1 CDS complement(68838..69833) product DUF4352 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070642.1 CDS complement(69914..70528) product calcium-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795210.1 CDS 70840..71322 product DUF4909 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840523.1 CDS 71481..72959 product 2-succinylbenzoate-CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene menE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348364.1 CDS 72964..73965 product o-succinylbenzoate synthase transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene menC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778528.1 CDS complement(73962..74219) product membrane protein insertion efficiency factor YidD transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene yidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718107.1 CDS 74279..74758 product nucleoside triphosphatase YtkD transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene rppH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672013.1 CDS 74739..75509 product S9 family peptidase transl_table 11 codon_start 1 locus_tag LOCUS_07410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822900.1 CDS 75884..76369 product IS200/IS605 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene tnp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829489.1 note frameshifted, insertion/deletion at around 75813,75806 CDS complement(76505..78097) product phosphoenolpyruvate carboxykinase (ATP) transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene pckA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 CDS 78468..79661 product S-adenosylmethionine synthase transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene metK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 CDS 79786..80694 product NERD domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366163.1 CDS 80906..81739 product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_07460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453306.1 CDS complement(81802..82146) product transposase transl_table 11 codon_start 1 locus_tag LOCUS_07470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874022.1 sequence04 source 1..38721 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date tRNA complement(93..168) product tRNA-Val locus_tag LOCUS_t00130 gene trnaV_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(192..265) product tRNA-Pro locus_tag LOCUS_t00140 gene trnaP_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(286..362) product tRNA-Arg locus_tag LOCUS_t00150 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(368..456) product tRNA-Leu locus_tag LOCUS_t00160 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(464..538) product tRNA-Gly locus_tag LOCUS_t00170 gene trnaG_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(571..645) product tRNA-Lys locus_tag LOCUS_t00180 inference COORDINATES:profile:Aragorn:1.2.38 tRNA complement(651..726) product tRNA-Thr locus_tag LOCUS_t00190 gene trnaT_1 inference COORDINATES:profile:Aragorn:1.2.38 assembly_gap 727..850 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1406..2893) product lysine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene lysS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 CDS complement(3432..3908) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene folK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613722.1 CDS complement(3905..4270) product dihydroneopterin aldolase transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene folB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154302.1 CDS complement(4248..5051) product dihydropteroate synthase transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene folP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167944.1 CDS complement(5267..6199) product cysteine synthase transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene cysK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057594.1 CDS complement(6378..7259) product redox-regulated molecular chaperone Hsp33 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene hslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 CDS complement(7488..9581) product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein transl_table 11 codon_start 1 locus_tag LOCUS_07540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167888.1 CDS complement(9838..10377) product hypoxanthine-guanine phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene hprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551283.1 CDS complement(10382..11677) product tRNA(Ile)-lysidine synthetase transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene tilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176709.1 CDS complement(11857..12258) product RNA-binding protein S1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021445.1 CDS complement(12363..12755) product cell division protein DIVIC transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene divIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792417.1 CDS complement(12773..13036) product RNA-binding S4 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_07590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234988.1 CDS complement(13033..14226) product nucleotide pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_07600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951441.1 CDS complement(14226..15752) product stage V sporulation protein B transl_table 11 codon_start 1 locus_tag LOCUS_07610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680740.1 CDS complement(15742..19248) product transcription-repair coupling factor transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene mfd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154218.1 CDS complement(19248..19820) product peptidyl-tRNA hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene pth inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649791.1 CDS complement(20131..20784) product 50S ribosomal protein L25/general stress protein Ctc transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rplY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 CDS complement(20934..21899) product ribose-phosphate diphosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene prs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933774.1 CDS complement(22046..23398) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene glmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252543.1 CDS complement(23742..24044) product stage V sporulation protein G transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene spoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868999.1 CDS complement(24116..24496) product RidA family protein transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene yabJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 CDS complement(24513..25337) product pur operon repressor transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene purR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269643.1 CDS complement(25351..26199) product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene ipk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638870.1 CDS complement(26509..26772) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene veg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126664.1 CDS complement(26872..27762) product dimethyladenosine transferase transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene ksgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886500.1 CDS complement(27776..28312) product ribonuclease M5 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rnmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700080.1 CDS complement(28479..29252) product TatD family deoxyribonuclease transl_table 11 codon_start 1 locus_tag LOCUS_07740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904312.1 CDS complement(29283..31256) product methionine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene metS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051129.1 CDS complement(31541..32380) product rRNA (cytidine-2'-O-)-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rsmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279926.1 CDS complement(32382..32630) product GIY-YIG nuclease family protein transl_table 11 codon_start 1 locus_tag LOCUS_07770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 CDS complement(32623..33348) product tRNA1(Val) (adenine(37)-N6)-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910686.1 CDS complement(33622..33969) product DNA replication initiation control protein YabA transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene yabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375683.1 CDS complement(33986..34789) product signal peptidase II transl_table 11 codon_start 1 locus_tag LOCUS_07800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134194.1 CDS complement(34790..35716) product DNA polymerase III subunit delta' transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene holB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344336.1 CDS complement(35930..36259) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene darA/pstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 CDS complement(36287..36904) product thymidylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene tmk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272126.1 CDS complement(36906..38243) product lysine decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_07840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812829.1 sequence05 source 1..20951 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(486..1550) product chromosome partitioning protein ParA transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene salA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958531.1 CDS complement(1698..3140) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene lmrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141007.1 CDS complement(3462..3929) product multidrug resistance efflux pump SepA transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene sepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636857.1 CDS complement(4034..5377) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene sdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237506.1 CDS complement(5554..6237) product hemolysin III transl_table 11 codon_start 1 locus_tag LOCUS_07890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047255.1 CDS complement(6256..7443) product uridylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_07900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884735.1 CDS complement(7487..8002) product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_07910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147095.1 CDS 8179..8439 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_07920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251935.1 CDS complement(8571..9941) product YjiH family protein transl_table 11 codon_start 1 locus_tag LOCUS_07930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447051.1 CDS complement(10177..11145) product iron-dicitrate ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene htsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989088.1 CDS complement(11142..12173) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene htsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974909.1 CDS complement(12185..13168) product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene htsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214661.1 CDS complement(13560..14630) product alanine racemase transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene sfnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951624.1 CDS complement(14637..16394) product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene sfnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262640.1 CDS complement(16381..17574) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene sfnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170400.1 CDS 17676..19652 product D-ornithine--citrate ligase SfnaD transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene sfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052571.1 CDS 20108..20908 product DUF772 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator sequence06 source 1..3842 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 414..1025 product DUF5080 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394911.1 CDS 1161..1379 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431307.1 CDS 1511..2011 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_08040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142138.1 CDS 2022..2522 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_08050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142044.1 CDS 2533..2685 product Protein of uncharacterized function, DUF600 transl_table 11 codon_start 1 locus_tag LOCUS_08060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2676 CDS 2729..3028 product Uncharacterized conserved protein transl_table 11 codon_start 1 locus_tag LOCUS_08070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 2676 CDS 3039..3530 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_08080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142138.1 sequence07 source 1..2558 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date tRNA 1..76 product tRNA-Thr locus_tag LOCUS_t00200 gene trnaT_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 82..157 product tRNA-Lys locus_tag LOCUS_t00210 gene trnaK inference COORDINATES:profile:Aragorn:1.2.38 tRNA 160..243 product tRNA-Leu locus_tag LOCUS_t00220 gene trnaL_1 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 246..320 product tRNA-Gly locus_tag LOCUS_t00230 gene trnaG_3 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 331..419 product tRNA-Leu locus_tag LOCUS_t00240 gene trnaL_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 437..512 product tRNA-Leu locus_tag LOCUS_t00250 gene trnaL_3 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 521..594 product tRNA-Pro locus_tag LOCUS_t00260 gene trnaP_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 612..687 product tRNA-Val locus_tag LOCUS_t00270 gene trnaV_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 709..783 product tRNA-Met locus_tag LOCUS_t00280 gene trnaM_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 811..884 product tRNA-Asp locus_tag LOCUS_t00290 gene trnaD_3 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 893..984 product tRNA-Ser locus_tag LOCUS_t00300 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 994..1069 product tRNA-Asp locus_tag LOCUS_t00310 gene trnaD_4 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1108..1200 product tRNA-Ser locus_tag LOCUS_t00320 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1214..1289 product tRNA-Met locus_tag LOCUS_t00330 gene trnaM_3 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1298..1373 product tRNA-Asp locus_tag LOCUS_t00340 gene trnaD_5 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1391..1465 product tRNA-Phe locus_tag LOCUS_t00350 gene trnaF_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1472..1546 product tRNA-Thr locus_tag LOCUS_t00360 gene trnaT_3 inference COORDINATES:profile:Aragorn:1.2.38 assembly_gap 1547..1703 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 1719..1792 product tRNA-Trp locus_tag LOCUS_t00370 gene trnaW inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1795..1868 product tRNA-His locus_tag LOCUS_t00380 gene trnaH_2 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1879..1950 product tRNA-His locus_tag LOCUS_t00390 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 1956..2029 product tRNA-Cys locus_tag LOCUS_t00400 gene trnaC inference COORDINATES:profile:Aragorn:1.2.38 tRNA 2037..2111 product tRNA-Gly locus_tag LOCUS_t00410 gene trnaG_4 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 2150..2233 product tRNA-Leu locus_tag LOCUS_t00420 gene trnaL_4 inference COORDINATES:profile:Aragorn:1.2.38 sequence08 source 1..1638 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 559..807 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1084..1350 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1359..1484 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator sequence09 source 1..1448 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 121..1323 product ISL3 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene tnp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557163.1 sequence10 source 1..614 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date tRNA 4..77 product tRNA-Glu locus_tag LOCUS_t00430 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 84..159 product tRNA-Val locus_tag LOCUS_t00440 gene trnaV_3 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 189..272 product tRNA-Tyr locus_tag LOCUS_t00450 gene trnaY inference COORDINATES:profile:Aragorn:1.2.38 tRNA 282..356 product tRNA-Gln locus_tag LOCUS_t00460 gene trnaQ inference COORDINATES:profile:Aragorn:1.2.38 tRNA 360..433 product tRNA-Lys locus_tag LOCUS_t00470 inference COORDINATES:profile:Aragorn:1.2.38 sequence11 source 1..409638 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 193..483 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 494..688 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 729..1079 product Ntox50 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 1086..1277 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053372.1 CDS complement(1261..1413) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(1826..2851) product low specificity L-threonine aldolase transl_table 11 codon_start 1 locus_tag LOCUS_08180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 CDS 3121..3318 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435068.1 CDS 3376..4857 product cardiolipin synthase transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene cls1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270822.1 CDS 5041..5940 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593436.1 CDS 5909..6640 product multidrug ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603970.1 CDS 6644..7735 product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_08230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670307.1 CDS 7732..8334 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_08240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202390.1 CDS complement(8447..8635) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027143.1 CDS 8774..9307 product thermonuclease transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene nuc2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 CDS complement(9450..10304) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011826.1 CDS 10626..11210 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001803470.1 CDS complement(11264..12646) product aspartate kinase transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene thrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868645.1 CDS 12837..14117 product homoserine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene hom inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735864.1 CDS 14123..15184 product threonine synthase transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene thrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255461.1 CDS 15186..16100 product homoserine kinase transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene thrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073180.1 CDS 16158..16961 product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_08330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186309.1 CDS complement(17254..17568) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580201.1 CDS complement(17786..19240) product gamma-aminobutyrate permease transl_table 11 codon_start 1 locus_tag LOCUS_08350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389956.1 CDS 19444..20961 product catalase transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene katA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082539.1 CDS 21052..21201 product 50S ribosomal protein L33 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rpmG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 CDS 21655..21924 product 30S ribosomal protein S14 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene rpsN2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085655.1 CDS 22081..23058 product guanosine monophosphate reductase transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene guaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688122.1 CDS 23233..24096 product secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_08400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380730.1 CDS complement(24476..25099) product LexA repressor transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene lexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 CDS 25242..25475 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499650.1 CDS 25611..25850 product DUF896 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_08430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 CDS 25971..27959 product transketolase transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene tkt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481443.1 CDS 28237..28479 product YneF family protein transl_table 11 codon_start 1 locus_tag LOCUS_08450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548645.1 CDS 28658..29125 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_08460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966142.1 CDS 29249..30370 product exonuclease sbcCD subunit D transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene sbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691301.1 CDS 30374..33403 product Nuclease SbcCD subunit C transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene sbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803135.1 CDS complement(33474..33836) product large-conductance mechanosensitive channel transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene mscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910489.1 CDS 34040..35686 product glycine betaine transporter transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene opuD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088978.1 CDS 36578..39283 product aconitate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene citB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729744.1 CDS 39463..39930 product 4-hydroxybenzoyl-CoA thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_08520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640487.1 CDS complement(40137..40433) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165377.1 CDS complement(40809..41417) product glycerol-3-phosphate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene plsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972779.1 CDS 41617..43614 product DNA topoisomerase IV subunit B transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene parE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557340.1 CDS 43614..46016 product DNA topoisomerase 4 subunit A transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene parC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289562.1 CDS 46266..47726 product alanine:cation symporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_08570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651160.1 CDS 48226..49077 product protein GlcT transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene glcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505015.1 CDS 49212..50420 product AI-2E family transporter transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene cozEb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004752.1 CDS 50901..53423 product phosphatidylglycerol lysyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene mprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071136.1 CDS complement(53626..54090) product peptide methionine sulfoxide reductase transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene msrA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024830.1 CDS 54272..55255 product regulatory protein MsrR transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene msrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356975.1 CDS complement(55343..55528) product tautomerase transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene dmpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123276.1 CDS 55676..56938 product DNA repair protein MucB transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene umuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283016.1 CDS complement(57075..58166) product prephenate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene tyrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214278.1 CDS 58331..59362 product M42 family metallopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_08660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433354.1 CDS 59854..61260 product anthranilate synthase component I transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene trpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350970.1 CDS 61257..61823 product glutamine amidotransferase transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene trpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604816.1 CDS 61829..62827 product anthranilate phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene trpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173833.1 CDS 62829..63611 product indole-3-glycerol phosphate synthase TrpC transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene trpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153613.1 CDS 63611..64243 product N-(5'-phosphoribosyl)anthranilate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene trpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768192.1 CDS 64236..65450 product tryptophan synthase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene trpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041351.1 CDS 65443..66171 product tryptophan synthase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene trpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163628.1 CDS 66493..67755 product aminoacyltransferase FemA transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene femA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673315.1 CDS 67774..69033 product aminoacyltransferase FemB transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene femB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673098.1 CDS 69716..70483 product Cof-type HAD-IIB family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_08760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213021.1 CDS complement(70531..71004) product SWIM zinc finger family protein transl_table 11 codon_start 1 locus_tag LOCUS_08770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523668.1 CDS complement(71128..71829) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene opp-2F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571259.1 CDS complement(71822..72595) product peptide ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene opp-2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052315.1 CDS complement(72582..73412) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene opp-2C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548936.1 CDS complement(73405..74391) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene opp-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469951.1 CDS complement(74695..75039) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_08820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171798.1 CDS 75244..77058 product oligoendopeptidase F transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene pepF_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077571.1 CDS complement(77198..77839) product phosphate transport system regulatory protein PhoU transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene phoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974847.1 CDS complement(77846..78697) product phosphate ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene pstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079447.1 CDS complement(78744..79661) product phosphate ABC transporter, permease protein PstA transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene pstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450297.1 CDS complement(79663..80589) product phosphate ABC transporter permease subunit PstC transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene pstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204619.1 CDS complement(80780..81763) product phosphate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene pstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759232.1 CDS 82303..82599 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_08890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874022.1 CDS complement(82735..83637) product virulence factor B transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene cvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162352.1 CDS 83784..85385 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_08910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942303.1 CDS 86245..87450 product aspartate kinase transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene lysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258716.1 CDS 87514..88503 product aspartate-semialdehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene asd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163523.1 CDS 88505..89392 product 4-hydroxy-tetrahydrodipicolinate synthase transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene dapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149278.1 CDS 89389..90111 product 4-hydroxy-tetrahydrodipicolinate reductase transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene dapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698231.1 CDS 90138..90857 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene dapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249839.1 CDS 91000..92151 product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_08970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003789.1 CDS 92156..93241 product alanine racemase 2 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene alr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127595.1 CDS 93231..94496 product diaminopimelate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene lysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216946.1 CDS complement(94736..95137) product protein msa transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene msa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876201.1 CDS complement(95334..95534) product cold-shock protein CspA transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene cspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 CDS complement(95705..96013) product DUF1033 family protein transl_table 11 codon_start 1 locus_tag LOCUS_09020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269923.1 CDS 96176..96445 product acylphosphatase transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene acyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215907.1 CDS 96470..97093 product 5-bromo-4-chloroindolyl phosphate hydrolysis protein transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene xpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788788.1 CDS 97125..98261 product tellurite resistance protein TelA transl_table 11 codon_start 1 locus_tag LOCUS_09050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138415.1 CDS complement(98528..98920) product Truncated transposase transl_table 11 codon_start 1 locus_tag LOCUS_09060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 98344,98557,98470 CDS complement(99273..100616) product branched-chain amino acid transport system II carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene brnQ3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 CDS complement(100841..102727) product nitric oxide reductase activation protein NorD transl_table 11 codon_start 1 locus_tag LOCUS_09080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283678.1 CDS complement(102741..103532) product MoxR family ATPase transl_table 11 codon_start 1 locus_tag LOCUS_09090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185421.1 CDS complement(103713..103916) product YozC transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene yozC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902175.1 CDS complement(103945..104754) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334518.1 CDS complement(105334..106602) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene sucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115439.1 CDS complement(106616..109414) product 2-oxoglutarate dehydrogenase E1 component transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene odhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180673.1 CDS complement(109698..111053) product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene arlS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166801.1 CDS complement(111050..111709) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene arlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192137.1 CDS complement(112179..112379) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184336.1 CDS complement(112496..113110) product phosphatase PAP2 family protein transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene pgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084769.1 CDS complement(113127..114197) product undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene murG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160906.1 CDS complement(114209..114718) product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620194.1 CDS complement(115118..116608) product Probable CtpA-like serine protease transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene ctpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342131.1 CDS complement(116800..117021) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801007.1 CDS complement(117021..117521) product glucose-specific phosphotransferase enzyme IIA component transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene crr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473653.1 CDS complement(117533..117961) product peptide-methionine (R)-S-oxide reductase MsrB transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene msrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913317.1 CDS complement(117954..118487) product peptide-methionine (S)-S-oxide reductase MsrA transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene msrA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159900.1 CDS complement(118573..119412) product fatty acid kinase FakB2 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene fakB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166063.1 CDS complement(119427..119906) product dihydrofolate reductase transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene dfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175746.1 CDS complement(120106..121062) product thymidylate synthase transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene thyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934894.1 CDS complement(121486..121923) product BrxA/BrxB family bacilliredoxin transl_table 11 codon_start 1 locus_tag LOCUS_09280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995287.1 CDS complement(121939..123063) product virulence factor C transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene cvfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404645.1 CDS complement(123101..123352) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691942.1 CDS complement(123364..123558) product zinc-finger domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001838183.1 CDS 123803..124507 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_09320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282171.1 CDS 125048..125449 product ribonuclease H transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rnhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062946.1 CDS complement(125508..154115) product extracellular matrix-binding protein ebh transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene ebh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP76 CDS complement(154513..155904) product multidrug efflux MFS transporter NorB transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene norB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414695.1 CDS complement(156061..157383) product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_09360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064778.1 CDS complement(157414..158454) product serine/threonine dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene ilvA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210817.1 CDS complement(158549..159667) product alanine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene ald inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 CDS complement(160142..161020) product 5'-3' exonuclease transl_table 11 codon_start 1 locus_tag LOCUS_09390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133021.1 CDS complement(161040..164480) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene dynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608509.1 CDS 164784..166124 product PepSY domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene cysJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798987.1 CDS complement(166330..166662) product DUF4889 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516798.1 CDS complement(166746..167891) product RNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487154.1 CDS complement(168542..168886) product cell cycle protein GpsB transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene gpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286320.1 CDS complement(168900..169463) product DUF1273 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241308.1 CDS complement(169456..169806) product YppE family protein transl_table 11 codon_start 1 locus_tag LOCUS_09460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000806.1 CDS complement(169861..170040) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788819.1 CDS 170346..170972 product Holliday junction resolvase RecU transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene recU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795446.1 CDS 170969..173152 product penicillin-binding protein 2 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene pbp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138336.1 CDS complement(173718..174059) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182021.1 CDS complement(174064..174723) product endonuclease III transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene nth inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253765.1 CDS complement(174713..175399) product chromosome replication protein DnaD transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene dnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362218.1 CDS complement(175727..177019) product asparagine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene asnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858779.1 CDS complement(177341..180034) product ATP-dependent helicase DinG transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene dinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525078.1 CDS complement(180058..181029) product Bifunctional ligase/repressor BirA transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene birA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049921.1 CDS complement(181016..182218) product CCA-adding enzyme transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene papS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361540.1 CDS complement(182223..183365) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene bshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690025.1 CDS complement(183606..183923) product nucleotide pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_09580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839926.1 CDS complement(184260..184958) product zinc metallopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_09590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001827022.1 CDS complement(185012..185599) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_09600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154683.1 CDS complement(185589..186164) product IDEAL domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005212.1 CDS complement(186178..187422) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831060.1 CDS complement(187429..188727) product 3-phosphoshikimate 1-carboxyvinyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene aroA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253231.1 CDS complement(188737..189801) product 3-dehydroquinate synthase transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene aroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776312.1 CDS complement(189827..190993) product chorismate synthase transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene aroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269921.1 CDS complement(191379..191579) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789522.1 CDS complement(191788..192237) product nucleoside-diphosphate kinase transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene ndk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442480.1 CDS complement(192329..193288) product Heptaprenyl diphosphate synthase component II transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene hepT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817755.1 CDS complement(193290..194015) product demethylmenaquinone methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene ubiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 CDS complement(194018..194590) product heptaprenyl pyrophosphate synthase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_09700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450555.1 CDS complement(195021..195293) product DNA-binding protein HU transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene hup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 CDS complement(195464..196462) product glycerol-3-phosphate dehydrogenase (NAD(P)(+)) transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene gpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 CDS complement(196479..197789) product ribosome biogenesis GTPase Der transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene engA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 CDS complement(198011..199186) product 30S ribosomal protein S1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133961.1 CDS complement(199443..199634) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800578.1 CDS complement(199898..200557) product cytidylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene cmk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644391.1 CDS 200634..201602 product L-asparaginase transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene ansA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681757.1 CDS complement(201717..202703) product YpdA family putative bacillithiol disulfide reductase transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene ypdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174258.1 CDS complement(203105..204565) product elastin-binding protein EbpS transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene ebpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069289.1 CDS complement(204718..206097) product ATP-dependent DNA helicase RecQ transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene recQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902099.1 CDS complement(206087..207040) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163801.1 CDS 207148..207396 product ferredoxin transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene fer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151997.1 CDS complement(207502..208047) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene ribU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 CDS complement(208644..209558) product DUF1672 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913243.1 CDS complement(209573..209779) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(209772..210662) product DUF1672 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557355.1 CDS complement(210780..211697) product DUF1672 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476346.1 CDS complement(211788..213950) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_09880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033761.1 CDS complement(213943..214812) product DUF1672 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476346.1 CDS complement(215117..216868) product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene srrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987774.1 CDS complement(216849..217574) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene srrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064078.1 CDS complement(217707..218444) product rRNA pseudouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene rluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159577.1 CDS complement(218437..218979) product SMC-Scp complex subunit ScpB transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene scpB_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368656.1 CDS complement(218972..219703) product segregation and condensation protein A transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene scpA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273371.1 CDS 219795..220301 product DUF309 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_09950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183429.1 CDS complement(220379..221266) product tyrosine recombinase XerD transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene xerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 CDS complement(221315..221764) product transcriptional repressor transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene fur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392691.1 CDS complement(221869..222411) product NUDIX hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene nudF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 CDS 222493..223401 product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_09990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171335.1 CDS complement(223617..223865) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995800.1 CDS complement(223881..224636) product SDR family oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_10010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678232.1 CDS 224808..225593 product pyrroline-5-carboxylate reductase transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene proC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779749.1 CDS complement(225698..226618) product ribonuclease Z transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene rnz inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454063.1 CDS complement(226675..226809) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 226931..228415 product glucose-6-phosphate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene zwf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105070.1 CDS 228645..229511 product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_10060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571108.1 CDS complement(229594..231243) product alpha-glucosidase transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene malA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041915.1 CDS complement(231259..232278) product LacI family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene malR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256319.1 CDS complement(232472..232843) product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_10090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413436.1 CDS complement(233062..234468) product phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating) transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene gnd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193707.1 CDS complement(234536..235669) product M20/M25/M40 family metallo-hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_10110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606693.1 CDS 235932..236111 product stressosome-associated protein Prli42 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene prli42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789875.1 CDS complement(236238..237218) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_10130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916196.1 CDS complement(237232..237669) product Bacilliredoxin (De-bacillithiolation) transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene brxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367419.1 CDS complement(238020..239294) product 2-oxo acid dehydrogenase subunit E2 transl_table 11 codon_start 1 locus_tag LOCUS_10150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406838.1 CDS complement(239307..240290) product alpha-ketoacid dehydrogenase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene bfmBAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096633.1 CDS complement(240290..241282) product 2-oxoisovalerate dehydrogenase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene bfmBAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568351.1 CDS complement(241298..242719) product dihydrolipoyl dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene lpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291533.1 CDS complement(242870..244549) product DNA repair protein RecN transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene recN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942210.1 CDS complement(244565..245017) product arginine repressor transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene argR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124985.1 CDS complement(245449..246330) product geranyltranstransferase transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ispA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183383.1 CDS complement(246308..246538) product exodeoxyribonuclease VII small subunit transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene xseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159865.1 CDS complement(246531..247868) product exodeoxyribonuclease 7 large subunit transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene xseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286928.1 CDS complement(247885..248274) product N utilization substance protein B transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene nusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087385.1 CDS complement(248334..248696) product Asp23/Gls24 family envelope stress response protein transl_table 11 codon_start 1 locus_tag LOCUS_10250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241588.1 CDS complement(248711..250066) product acetyl-CoA carboxylase biotin carboxylase subunit transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene accC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756612.1 CDS complement(250066..250530) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene accB_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 CDS complement(251004..251561) product elongation factor P transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene efp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626504.1 CDS complement(251587..252648) product peptidase M24 family protein transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene pepQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 CDS 252753..253334 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737686.1 CDS 253348..253566 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_10310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244298.1 CDS complement(253630..254460) product octanoyltransferase LipM transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene lipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 CDS 254618..255004 product rhodanese transl_table 11 codon_start 1 locus_tag LOCUS_10330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276571.1 CDS complement(255369..256841) product Probable glycine dehydrogenase (decarboxylating) subunit 2 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene gcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202188.1 CDS complement(256834..258180) product Probable glycine dehydrogenase (decarboxylating) subunit 1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene gcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019691.1 CDS complement(258200..259291) product aminomethyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene gcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093349.1 CDS complement(259450..259974) product shikimate kinase transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene aroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015120.1 CDS complement(260207..260581) product prepilin-type N-terminal cleavage/methylation domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_10380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788897.1 CDS complement(260622..260921) product competence protein ComGE transl_table 11 codon_start 1 locus_tag LOCUS_10390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072398116.1 CDS complement(260908..261342) product prepilin-type cleavage/methylation domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene comGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788899.1 CDS complement(261332..261643) product competence protein ComGC transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene comGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472256.1 CDS complement(261657..262577) product type II secretion system F family protein transl_table 11 codon_start 1 locus_tag LOCUS_10420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776422.1 CDS complement(262699..263673) product type II/IV secretion system protein transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene comGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697220.1 CDS complement(263725..264348) product MBL fold metallo-hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_10440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223008.1 CDS complement(264345..264674) product MTH1187 family thiamine-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_10450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018871.1 CDS complement(264674..265660) product glucokinase transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene glk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161311.1 CDS complement(265657..265860) product YqgQ family protein transl_table 11 codon_start 1 locus_tag LOCUS_10470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087561.1 CDS complement(265841..267304) product Rhomboid family intramembrane serine protease transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene gluP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017867.1 CDS complement(267316..267909) product 5-formyltetrahydrofolate cyclo-ligase transl_table 11 codon_start 1 locus_tag LOCUS_10490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164546.1 CDS complement(268064..268213) product 50S ribosomal protein L33 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene rpmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265709.1 CDS complement(268326..270401) product penicillin-binding protein 3 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene pbp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919769.1 CDS complement(270522..271121) product superoxide dismutase transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene sodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863556.1 CDS complement(271397..271807) product transcriptional repressor transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 CDS complement(271794..272657) product metal ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene znuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564315.1 CDS complement(272699..273484) product zinc ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene znuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 CDS complement(273610..274500) product endonuclease transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene nfo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 CDS complement(274510..275856) product DEAD/DEAH box family ATP-dependent RNA helicase transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene cshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062176.1 CDS complement(275970..277070) product Nif3-like dinuclear metal center hexameric protein transl_table 11 codon_start 1 locus_tag LOCUS_10580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683940.1 CDS complement(277073..277750) product tRNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene trmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624577.1 CDS complement(277881..278987) product RNA polymerase sigma factor SigA transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene sigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283055.1 CDS complement(279211..281010) product DNA primase transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene dnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217257.1 CDS complement(281071..281889) product phosphoenolpyruvate synthetase regulatory protein transl_table 11 codon_start 1 locus_tag LOCUS_10620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411298.1 CDS complement(281900..282439) product helix-turn-helix transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_10630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797828.1 CDS 282858..284249 product glycine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene glyS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030080.1 CDS complement(284399..285151) product DNA repair protein RecO transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene recO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557361.1 CDS complement(285173..286072) product GTPase Era transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene bex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 CDS complement(286073..286477) product cytidine deaminase transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene cdd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121875.1 CDS complement(286488..286832) product diacylglycerol kinase transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene dgkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 CDS complement(286835..287302) product endoribonuclease YbeY transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene ybeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 CDS complement(287303..288250) product PhoH family protein transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene phoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 CDS complement(288554..289252) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110600.1 CDS complement(289269..290258) product flotillin-like protein FloA transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene floA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492108.1 CDS complement(290276..290983) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_10730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802667.1 CDS complement(291203..291379) product 30S ribosomal protein S21 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rpsU inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(291672..293018) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene mtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108668.1 CDS complement(293025..293786) product 16S rRNA (uracil(1498)-N(3))-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene rsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 CDS complement(293779..294717) product 50S ribosomal protein L11 methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene prmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104607.1 CDS complement(294721..295860) product molecular chaperone DnaJ transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene dnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119021.1 CDS complement(295996..297828) product molecular chaperone DnaK transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene dnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034716.1 CDS complement(297897..298523) product nucleotide exchange factor GrpE transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene grpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182211.1 CDS complement(298555..299532) product HrcA family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene hrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627144.1 CDS complement(299633..300757) product oxygen-independent coproporphyrinogen III oxidase transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene hemN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218103.1 CDS complement(301320..303143) product elongation factor 4 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene lepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368338.1 CDS 303489..303740 product 30S ribosomal protein S20 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene rpsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274017.1 CDS complement(303785..304759) product DNA polymerase III subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene holA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 CDS complement(304816..306996) product DNA internalization-related competence protein ComEC/Rec2 transl_table 11 codon_start 1 locus_tag LOCUS_10860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953309.1 CDS complement(307022..307453) product ComE operon protein 2 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene comEB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 CDS complement(307575..308252) product competence protein ComE transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene comEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802022.1 CDS complement(308301..309017) product SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084830.1 CDS complement(309020..309373) product ribosome silencing factor RsfS transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene rsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088020.1 CDS complement(309374..309958) product haloacid dehalogenase transl_table 11 codon_start 1 locus_tag LOCUS_10910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019324.1 CDS complement(309948..310517) product nicotinate-nicotinamide nucleotide adenylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene nadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725167.1 CDS complement(310520..310810) product ribosome assembly RNA-binding protein YhbY transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene yhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 CDS complement(310814..311620) product shikimate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene aroE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666757.1 CDS complement(311634..312734) product ribosome biogenesis GTPase YqeH transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene yqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280137.1 CDS complement(312735..313262) product YqeG family HAD IIIA-type phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_10960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524903.1 CDS complement(313282..313968) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene mtnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579275.1 CDS 314282..314551 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_10980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829749.1 CDS complement(314753..315505) product enterotoxin transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene entA inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(315919..317139) product Fic family protein transl_table 11 codon_start 1 locus_tag LOCUS_11000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 CDS complement(317428..318657) product divalent metal cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_11010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533238.1 CDS complement(318670..319422) product 5-oxoprolinase subunit PxpA transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene pxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261793.1 CDS complement(319422..320783) product acetyl-CoA carboxylase biotin carboxylase subunit transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene accC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942744.1 CDS complement(320797..321246) product Acetyl-CoA carboxylase, biotin carboxyl carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene accB_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019340.1 CDS complement(321248..322258) product allophanate hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_11050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023319.1 CDS complement(322248..322982) product 5-oxoprolinase subunit PxpB transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene pxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383180.1 CDS complement(323308..323784) product transcription elongation factor GreA transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene greA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 CDS complement(323812..324435) product uridine kinase transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene udk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 CDS complement(324435..325703) product U32 family peptidase transl_table 11 codon_start 1 locus_tag LOCUS_11090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848304.1 CDS complement(325715..326638) product peptidase U32 transl_table 11 codon_start 1 locus_tag LOCUS_11100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137774.1 CDS complement(326641..327279) product O-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene trmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342258.1 CDS complement(327564..327872) product DUF1292 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_11120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134779.1 CDS complement(327887..328315) product Holliday junction resolvase RuvX transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene ruvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939059.1 CDS complement(328319..328579) product IreB family regulatory phosphoprotein transl_table 11 codon_start 1 locus_tag LOCUS_11140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426912.1 CDS complement(328642..331272) product alanine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene alaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734075.1 CDS complement(331615..334092) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene recD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283312.1 CDS complement(334094..334762) product tetratricopeptide repeat protein transl_table 11 codon_start 1 locus_tag LOCUS_11170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567017.1 CDS complement(335224..336342) product tRNA 2-thiouridine(34) synthase MnmA transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene mnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066097.1 CDS complement(336343..337485) product cysteine desulfurase transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene iscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409157.1 CDS 337797..338810 product LLM class flavin-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_11200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985878.1 CDS complement(339047..339193) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(339233..339415) product CsbD family protein transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene csbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752909.1 CDS complement(339515..339937) product Rrf2 family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene cymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704122.1 CDS 340022..341296 product recombinase RarA transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene rarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102729.1 CDS complement(341457..342230) product tRNA threonylcarbamoyladenosine dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene tcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682646.1 CDS complement(342691..344457) product aspartate--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene aspS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044799.1 CDS complement(344473..345735) product histidine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene hisS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 CDS complement(346196..347071) product cell wall amidase transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene lytH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717800.1 CDS complement(347068..347520) product D-tyrosyl-tRNA(Tyr) deacylase transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene dtd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869983.1 CDS complement(347532..349721) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene relA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058587.1 CDS complement(350149..350667) product adenine phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene apt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364542.1 CDS complement(350689..352962) product single-stranded-DNA-specific exonuclease RecJ transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene recJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595011.1 CDS complement(353165..355444) product protein translocase subunit SecDF transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene secDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749795.1 CDS complement(355719..355979) product preprotein translocase subunit YajC transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene yajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160682.1 CDS complement(355998..357137) product tRNA guanosine(34) transglycosylase Tgt transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 CDS complement(357160..358185) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene queA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019178.1 CDS complement(358187..359191) product Holliday junction branch migration DNA helicase RuvB transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ruvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005768.1 CDS complement(359223..359825) product Holliday junction branch migration protein RuvA transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene ruvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271550.1 CDS complement(359839..360294) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene thrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368902.1 CDS complement(360307..361599) product GTPase ObgE transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene obgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496100.1 CDS complement(361954..362238) product 50S ribosomal protein L27 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene rpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 CDS complement(362250..362570) product ribosomal-processing cysteine protease Prp transl_table 11 codon_start 1 locus_tag LOCUS_11420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633692.1 CDS complement(362576..362884) product 50S ribosomal protein L21 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene rplU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 CDS complement(363051..363581) product rod shape-determining protein MreD transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene mreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259925.1 CDS complement(363581..364423) product rod shape-determining protein MreC transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene mreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911041.1 CDS complement(364816..365289) product DUF4930 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_11460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236734.1 CDS 365449..365646 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025835.1 CDS complement(365763..366047) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171859.1 CDS complement(366115..366801) product DNA repair RadC family protein transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene radC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445860.1 CDS complement(366798..367361) product prepilin peptidase transl_table 11 codon_start 1 locus_tag LOCUS_11500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261115.1 CDS complement(367775..369046) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene folC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108346.1 CDS complement(369059..371689) product valine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene valS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 CDS 372092..372652 product DNA-3-methyladenine glycosylase I transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene tag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001237.1 CDS complement(372875..373948) product aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_11540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177998.1 CDS complement(374144..375430) product glutamate-1-semialdehyde 2,1-aminomutase transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene hemL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270865.1 CDS complement(375478..376452) product delta-aminolevulinic acid dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene hemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667126.1 CDS complement(376455..377123) product uroporphyrinogen III methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene hemD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805951.1 CDS complement(377145..378071) product hydroxymethylbilane synthase transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene hemC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230232.1 CDS complement(378113..378928) product cytochrome c assembly protein transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene hemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157329.1 CDS complement(378950..380296) product glutamyl-tRNA reductase transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene hemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545451.1 CDS complement(380513..381103) product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene engB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867697.1 CDS complement(381257..382519) product ATP-dependent Clp protease ATP-binding subunit ClpX transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene clpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472302.1 CDS complement(382670..383971) product trigger factor transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene tig inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 CDS complement(384134..385063) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280022.1 CDS complement(385082..385690) product DNA mismatch repair protein MutT transl_table 11 codon_start 1 locus_tag LOCUS_11650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032657.1 CDS complement(385832..386188) product 50S ribosomal protein L20 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene rplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 CDS complement(386235..386435) product 50S ribosomal protein L35 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene rpmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125540.1 CDS complement(386464..386991) product translation initiation factor IF-3 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene infC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791162.1 CDS complement(387220..388713) product gamma-aminobutyrate permease transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene lysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049145.1 CDS complement(389139..391076) product threonine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene thrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 CDS complement(391489..392409) product primosomal protein DnaI transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene dnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808621.1 CDS complement(392409..393809) product helicase DnaB transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene dnaB_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533479.1 CDS complement(393810..394280) product transcriptional regulator NrdR transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene nrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650082.1 CDS complement(394490..395515) product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene gapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106141.1 CDS complement(395685..396308) product Dephospho-CoA kinase transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene coaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127167.1 CDS complement(396324..397196) product DNA-formamidopyrimidine glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene mutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114454.1 CDS complement(397212..399842) product DNA polymerase I transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene polA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 CDS complement(400136..401623) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_11780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849428.1 CDS complement(402122..403762) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene phoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445861.1 CDS complement(403783..404487) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene phoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080028.1 CDS complement(404877..406145) product isocitrate dehydrogenase (NADP(+)) transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene citC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123165.1 CDS complement(406194..407240) product citrate synthase transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene citZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829167.1 CDS 407663..409024 product alanine glycine permease transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene aapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818525.1 sequence12 source 1..352794 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(1891..2247) product Staphylococcal accessory regulator T transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene sarT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069993647.1 CDS 2573..3316 product HTH-type transcriptional regulator SarU transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene sarU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386367.1 CDS complement(3527..4393) product UTP--glucose-1-phosphate uridylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene gtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721336.1 CDS complement(4573..7395) product fibronectin-binding protein A transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene fnbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841404.1 CDS complement(8077..11133) product fibronectin-binding protein FnbA transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene fnbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794614.1 CDS complement(11267..11569) product Fibronectin-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_11890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(11601..12959) product gluconate permease transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene gntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481425.1 CDS complement(13076..14629) product gluconate kinase transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene gntK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876638.1 CDS complement(14653..15333) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene gntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990133.1 CDS complement(15487..16251) product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_11930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074011.1 CDS complement(16416..17108) product GTP pyrophosphokinase transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene relP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289136.1 CDS complement(17339..17755) product DUF2188 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_11950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117049.1 CDS complement(17894..19786) product FUSC family protein transl_table 11 codon_start 1 locus_tag LOCUS_11960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557523.1 CDS complement(20195..21472) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_11970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 CDS 22019..22630 product DedA family protein transl_table 11 codon_start 1 locus_tag LOCUS_11980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435046.1 CDS complement(22727..23890) product putative MFS-type transporter YvmA transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene yvmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34307 CDS complement(23883..24347) product Transcriptional regulator, MarR family transl_table 11 codon_start 1 locus_tag LOCUS_12000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 24775..25470 product lantibiotic ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538625.1 CDS 25472..26242 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_12020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536961.1 CDS 26615..28579 product fructose 1,6-bisphosphatase transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene fbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192172.1 CDS 28592..28804 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 28950..30002 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_12050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443661.1 CDS complement(30107..30700) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400021.1 CDS complement(30722..31690) product ring-cleaving dioxygenase transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene mhqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609346.1 CDS complement(31768..32202) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene mhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376235.1 CDS 32429..32713 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067116.1 CDS 32884..33690 product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_12100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863968.1 CDS complement(33810..34481) product NAD(P)H-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene frp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069098.1 CDS 34751..35743 product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_12120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161545.1 CDS complement(35992..36792) product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237528.1 CDS 37113..37652 product ATP-binding cassette domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_12140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773921.1 note possible pseudo due to internal stop codon CDS 37763..38485 product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_12150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801924.1 CDS complement(38645..39265) product class A sortase SrtA transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene srtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759366.1 CDS 39459..39950 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617356.1 CDS complement(40388..40558) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549802.1 CDS complement(40737..41636) product L-serine dehydratase, iron-sulfur-dependent subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene sdaAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460421.1 CDS complement(41650..42330) product L-serine dehydratase, iron-sulfur-dependent subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene sdaAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140234.1 CDS complement(42333..43376) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822491.1 CDS 43927..44130 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177186.1 CDS 44322..45248 product EamA family transporter transl_table 11 codon_start 1 locus_tag LOCUS_12230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072362001.1 CDS complement(45330..46298) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228167.1 CDS complement(46431..46775) product thiol reductase thioredoxin transl_table 11 codon_start 1 locus_tag LOCUS_12250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240663.1 CDS complement(46817..47227) product acyl-CoA thioester hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206031.1 CDS complement(47607..49673) product PTS glucoside EIICBA component transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene glcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473678.1 CDS complement(49974..51713) product pyruvate oxidase transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene cidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062663.1 CDS complement(51760..52449) product holin-like protein CidB transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene cidB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001019.1 CDS complement(52442..52837) product holin-like protein CidA transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene cidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549734.1 CDS complement(53050..53928) product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene cidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549809.1 CDS 54095..54313 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011687.1 CDS 54703..55134 product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_12330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455861.1 CDS complement(55894..56151) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(56730..58007) product hydroxymethylglutaryl-CoA reductase, degradative transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene mvaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190998.1 CDS 58261..59427 product hydroxymethylglutaryl-CoA synthase transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene mvaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 CDS complement(59597..60118) product methylated-DNA--[protein]-cysteine S-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene adaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455988.1 CDS 60527..62632 product ATP-dependent Clp protease ATP-binding subunit transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene clpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058993.1 CDS complement(62701..62871) product FeoB-associated Cys-rich membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_12390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111117.1 CDS complement(62884..64878) product ferrous iron transporter B transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene feoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432915.1 CDS complement(64890..65117) product Ferrous iron transport protein A transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene feoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932073.1 CDS complement(65333..67822) product fatty acid efflux MMPL transporter FarE transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene farE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835496.1 CDS 67967..68515 product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene farR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665238.1 CDS complement(68871..70415) product L-glutamate gamma-semialdehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene rocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259692.1 CDS complement(70605..71204) product maltose O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136487.1 CDS 71443..71634 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene cwrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221404.1 CDS 71874..74282 product copper-exporting P-type ATPase A transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene copA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 CDS 74562..74768 product copper chaperone CopZ transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene copZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 CDS complement(74858..75856) product lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_12490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161369.1 CDS complement(75879..77033) product N-succinyldiaminopimelate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_12500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625061.1 CDS complement(77460..78968) product squalene synthase transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene crtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686168.1 CDS complement(78980..79843) product dehydrosqualene synthase transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene crtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178308.1 CDS complement(79880..81007) product 4,4'-diaponeurosporenoate glycosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene crtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871744.1 CDS complement(81013..82506) product diapolycopene oxygenase transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene crtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 CDS complement(82499..82996) product glycosyl-4,4'-diaponeurosporenoate acyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene crtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 CDS complement(83162..83929) product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_12560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725225.1 CDS complement(84290..86101) product O-acetyltransferase OatA transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene oatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379821.1 CDS complement(86613..87101) product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996739.1 CDS complement(87377..88078) product transglycosylase IsaA transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene isaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751263.1 CDS complement(88686..89741) product PTS transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_12600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200684.1 CDS 90118..90720 product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 CDS 91098..91418 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 91638..91868 product DUF896 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_12630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697134.1 CDS complement(92018..92395) product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_12640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616225.1 CDS complement(92412..93233) product NmrA/HSCARG family protein transl_table 11 codon_start 1 locus_tag LOCUS_12650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651837.1 CDS complement(93253..93552) product DUF2316 family protein transl_table 11 codon_start 1 locus_tag LOCUS_12660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055856.1 CDS 93683..94240 product TetR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene gbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224187.1 CDS 94233..94937 product short-chain dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene gbaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 CDS 95035..96045 product amidohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836421.1 CDS 96065..96895 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448918.1 CDS complement(97042..97932) product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_12710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706515.1 CDS complement(98030..98284) product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_12720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 98556 CDS 98265..98432 product Ferrous iron transporter protein B transl_table 11 codon_start 1 locus_tag LOCUS_12730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(98545..99369) product ferrous iron transporter B transl_table 11 codon_start 1 locus_tag LOCUS_12740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 98556 CDS complement(99363..100469) product Baeyer-Villiger flavin-containing monooxygenase transl_table 11 codon_start 1 locus_tag LOCUS_12750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163746.1 CDS complement(100803..101099) product type II secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_12760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447709.1 CDS complement(101087..101455) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066369.1 CDS complement(101470..101748) product TIGR04197 family type VII secretion effector transl_table 11 codon_start 1 locus_tag LOCUS_12780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020977619.1 CDS complement(102090..102956) product fructosamine kinase family protein transl_table 11 codon_start 1 locus_tag LOCUS_12790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005523.1 CDS 103174..104238 product dihydroorotate dehydrogenase (quinone) transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene pyrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277419.1 CDS 104393..104668 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159839.1 CDS complement(104854..105576) product Epoxyqueuosine reductase QueH transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene queH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606210.1 CDS 105930..106379 product VOC family protein transl_table 11 codon_start 1 locus_tag LOCUS_12830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125705.1 CDS complement(106460..107047) product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_12840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151110.1 CDS 107180..108862 product CocE/NonD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_12850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071595.1 CDS complement(108991..109374) product aspartate 1-decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene panD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789904.1 CDS complement(109376..110227) product pantoate--beta-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene panC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163737.1 CDS complement(110220..111038) product 3-methyl-2-oxobutanoate hydroxymethyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene panB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860047.1 CDS 111111..111971 product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_12890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953572.1 CDS complement(112057..112761) product acetolactate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene budA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186117.1 CDS complement(113039..113998) product L-lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene ldh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846636.1 CDS 114685..116133 product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_12920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534425.1 CDS complement(116214..117551) product aspartate aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_12930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030072.1 CDS 117809..118225 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237629.1 CDS 118348..119238 product class I fructose-bisphosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene fdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031409.1 CDS complement(119431..120927) product malate:quinone oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene lqo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130051.1 CDS 121223..121552 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_12970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791980.1 CDS complement(121612..123210) product acetyl-CoA synthetase transl_table 11 codon_start 1 locus_tag LOCUS_12980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172341.1 CDS complement(123404..123847) product antibiotic biosynthesis monooxygenase transl_table 11 codon_start 1 locus_tag LOCUS_12990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028775.1 CDS complement(124128..124340) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011688.1 CDS complement(124618..126327) product oxygen-dependent choline dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene betA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066521.1 CDS complement(126588..128078) product betaine-aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene betB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421713.1 CDS 128331..128894 product GbsR/MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198598.1 CDS complement(129082..129768) product MBL fold hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_13040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(130032..131654) product choline transporter BetT transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene cudT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711870.1 CDS complement(132173..132709) product anaerobic ribonucleoside-triphosphate reductase activating protein transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene nrdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173331.1 CDS complement(132706..134556) product anaerobic ribonucleoside-triphosphate reductase transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene nrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071729.1 CDS complement(134803..136173) product citrate transporter transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene citM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 CDS complement(136666..137271) product precorrin-2 dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_13090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057052.1 CDS complement(137334..139214) product assimilatory sulfite reductase (NADPH) flavoprotein subunit transl_table 11 codon_start 1 locus_tag LOCUS_13100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775150.1 CDS complement(139609..140106) product glutathione peroxidase transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene gpxA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065268.1 CDS complement(140116..140367) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791974.1 CDS complement(141530..143530) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene nsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776751.1 CDS complement(143527..144282) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene nsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923760.1 CDS complement(144390..145277) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene nsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143425.1 CDS complement(145288..145953) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene nsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697877.1 CDS complement(145979..146179) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604730.1 CDS 146377..147801 product alkaline phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene phoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953755.1 CDS complement(148084..148539) product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106185.1 CDS complement(148784..149545) product esterase family protein transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene estA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323441.1 CDS complement(149661..152294) product Clumping factor B transl_table 11 codon_start 1 locus_tag LOCUS_13210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(152644..153348) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene arcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138218.1 CDS complement(153447..154388) product carbamate kinase 2 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene arcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660028.1 CDS complement(154405..155835) product arginine-ornithine antiporter transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene arcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005835.1 CDS complement(155926..156936) product ornithine carbamoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene arcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136162.1 CDS complement(156969..158204) product arginine deiminase transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene arcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129417.1 CDS complement(158551..159000) product ArgR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene argR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748760.1 CDS complement(159367..160896) product peptidase M4 family protein transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene aur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001821522.1 CDS complement(161320..161847) product immunodominant staphylococcal antigen IsaB transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene isaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044560.1 CDS 162105..162563 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734801.1 CDS 162803..164677 product PTS mannose transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_13310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887022.1 CDS 164754..166706 product PTS mannose transporter subunit IIABC transl_table 11 codon_start 1 locus_tag LOCUS_13320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706111.1 CDS 166720..167658 product mannose-6-phosphate isomerase, class I transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene pmi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173201.1 CDS complement(167770..170751) product phage infection protein transl_table 11 codon_start 1 locus_tag LOCUS_13340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786115.1 CDS 170962..172821 product N-acetylmuramoyl-L-alanine amidase transl_table 11 codon_start 1 locus_tag LOCUS_13350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125628.1 CDS complement(173088..173648) product cysteine hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_13360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 CDS complement(173816..175723) product cell-wall-anchored protein SasF transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene sasF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151890.1 CDS complement(175965..177323) product accessory Sec system glycosylation chaperone GtfB transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene gtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593156.1 CDS complement(177316..178824) product accessory Sec system glycosyltransferase GtfA transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene gtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158423.1 CDS complement(178842..181232) product accessory Sec system translocase SecA2 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene secA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680945.1 CDS complement(181222..182181) product accessory Sec system protein Asp3 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene asp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916728.1 CDS complement(182159..183727) product accessory Sec system protein Asp2 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137481.1 CDS complement(183717..185270) product accessory Sec system protein Asp1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873204.1 CDS complement(185281..186492) product accessory Sec system protein translocase subunit SecY2 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene secY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916127.1 CDS complement(186622..186993) product LPXTG cell wall anchor domain-containing protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_13450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 186974..187738 product LPXTG cell wall anchor domain-containing protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_13460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 186989 note possible pseudo due to internal stop codon CDS 187862..189070 product Adhesin SraP transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene sraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 189350..190150 product LPXTG cell wall anchor domain-containing protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_13480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 190328..190606 product Serine-rich repeat glycoprotein adhesin SasA (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_13490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 190616..191140 product Serine-rich repeat glycoprotein adhesin SasA (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene sasA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 191180..191422 product Serine-rich repeat glycoprotein adhesin SasA (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene sasA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(193982..194674) product flavin reductase transl_table 11 codon_start 1 locus_tag LOCUS_13520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 CDS 194940..195368 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549854.1 CDS 195355..195657 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260044.1 CDS 195811..196170 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603479.1 CDS complement(196255..196866) product flavin reductase family protein transl_table 11 codon_start 1 locus_tag LOCUS_13560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287924.1 CDS complement(196945..197421) product methionine sulfoxide reductase A transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene msrA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261962.1 CDS complement(197424..197924) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_13580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244277.1 CDS complement(198159..198926) product capsular polysaccharide biosynthesis protein Cap8C transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene cap1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565310.1 CDS complement(198923..199615) product capsular polysaccharide biosynthesis protein Cap5B transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene cap1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185863.1 CDS complement(199632..200294) product capsular polysaccharide biosynthesis protein CapA transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene cap1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659683.1 CDS complement(201143..201703) product biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene icaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653261.1 CDS 201993..203105 product poly-beta-1,6 N-acetyl-D-glucosamine synthase transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene icaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 CDS 203069..203374 product poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene icaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240580.1 CDS 203371..204243 product intercellular adhesin biosynthesis polysaccharide N-deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene icaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877369.1 CDS 204230..205282 product poly-beta-1,6-N-acetyl-D-glucosamine export protein transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene icaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723836.1 CDS complement(205729..207774) product YSIRK domain-containing triacylglycerol lipase Lip1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene lip1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842040.1 CDS complement(208492..208704) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_13680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(208864..209496) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene hisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170491.1 CDS complement(209493..210251) product imidazole glycerol phosphate synthase cyclase subunit transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene hisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592596.1 CDS complement(210248..210952) product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene hisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571742.1 CDS complement(210945..211523) product imidazole glycerol phosphate synthase subunit HisH transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene hisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635623.1 CDS complement(211520..212098) product imidazoleglycerol-phosphate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene hisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640266.1 CDS complement(212067..213080) product histidinol-phosphate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene hisC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639184.1 CDS complement(213096..214352) product Histidinol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene hisD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930649.1 CDS complement(214339..214953) product ATP phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene hisG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944149.1 CDS complement(214971..215789) product ATP phosphoribosyltransferase regulatory subunit transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene hisZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065591.1 CDS complement(216094..217218) product polysaccharide deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_13780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549222.1 CDS complement(217336..217833) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_13790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610973.1 CDS complement(217880..218713) product energy-coupling factor transporter transmembrane protein EcfT transl_table 11 codon_start 1 locus_tag LOCUS_13800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077823.1 CDS complement(218710..220422) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_13810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138654.1 CDS complement(220475..221029) product DUF3816 family protein transl_table 11 codon_start 1 locus_tag LOCUS_13820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743711.1 CDS complement(221058..221906) product DNA-directed RNA polymerase subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_13830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 CDS 222286..222801 product polyisoprenoid-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_13840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181124.1 CDS complement(222950..223921) product lactonase transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene drp35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082559.1 CDS 224165..225121 product tRNA uridine(34) hydroxylase transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene trhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109281.1 CDS 225273..225911 product pyrrolidone-carboxylate peptidase transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene pcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547838.1 CDS complement(226030..226797) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_13880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956429.1 CDS complement(226787..227125) product PadR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_13890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116416.1 CDS 227292..227756 product DinB family protein transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene bstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208909.1 CDS 227994..229412 product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_13910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432352.1 CDS complement(229825..230733) product protein RarD transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene rarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019815.1 CDS 230958..231533 product DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_13930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174573.1 CDS 231698..232714 product nickel transporter NixA transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene nixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 CDS 232957..233751 product arylamine N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_13950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017423.1 CDS complement(233885..234397) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_13960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410764.1 CDS 234680..235438 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene vraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154162.1 CDS 235428..237308 product peptide resistance ABC transporter permease subunit VraE transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene vraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143647.1 CDS 237401..237592 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene vraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672033.1 CDS 237730..238140 product Mobile element protein transl_table 11 codon_start 1 locus_tag LOCUS_14000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 238110 CDS complement(238200..238697) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator assembly_gap 239110..239225 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 239657..239857 product cold-shock protein transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene cspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059079.1 CDS complement(239984..240553) product helix-turn-helix transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054128.1 CDS complement(240813..241208) product DUF3147 family protein transl_table 11 codon_start 1 locus_tag LOCUS_14040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779134.1 CDS complement(241276..241629) product DUF3147 family protein transl_table 11 codon_start 1 locus_tag LOCUS_14050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491382.1 CDS 241817..241966 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617169.1 CDS complement(242083..242922) product nucleoid occlusion protein transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene noc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742837.1 CDS complement(242965..243684) product ribosomal RNA small subunit methyltransferase G transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene gidB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215587.1 CDS complement(243684..245561) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene gidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249657.1 CDS complement(245628..247007) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene mnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362509.1 CDS complement(247146..247499) product ribonuclease P protein component transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene rnpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789343.1 CDS complement(247620..247757) product 50S ribosomal protein L34 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene rpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 248488..249849 product chromosomal replication initiator protein DnaA transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290433.1 CDS 250127..251260 product DNA polymerase III subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene dnaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969811.1 CDS 251650..251886 product S4 domain-containing protein YaaA transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene yaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789359.1 CDS 251883..252995 product DNA replication and repair protein RecF transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene recF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775113.1 CDS 253005..254939 product DNA gyrase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene gyrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255578.1 CDS 254976..257639 product DNA gyrase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene gyrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819096.1 CDS complement(257726..258538) product NAD(P)H-hydrate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene nnrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449218.1 CDS 258864..260378 product histidine ammonia-lyase transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene hutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177465.1 CDS 260757..262043 product serine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene serS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884332.1 CDS 262693..263388 product AzlC family ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_14220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190726.1 CDS 263385..263714 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_14230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628051.1 CDS 264077..265045 product homoserine O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene metX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186490.1 CDS 265351..266274 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_14250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800884.1 CDS 266289..268256 product DHH family phosphoesterase transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene gdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081640.1 CDS 268253..268705 product 50S ribosomal protein L9 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rplI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864305.1 CDS 268737..270137 product replicative DNA helicase transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene dnaB_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375647.1 CDS 270415..271698 product adenylosuccinate synthetase transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene purA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095328.1 tRNA 272128..272202 product tRNA-Glu locus_tag LOCUS_t00480 gene trnaE inference COORDINATES:profile:Aragorn:1.2.38 tRNA 272210..272282 product tRNA-Asp locus_tag LOCUS_t00490 gene trnaD_6 inference COORDINATES:profile:Aragorn:1.2.38 CDS 272902..273603 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene walR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101976.1 CDS 273616..275442 product sensory box histidine kinase VicK transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene walK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871607.1 CDS 275435..276769 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene walH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060140.1 CDS 276770..277558 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene walI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104165.1 CDS 277957..278748 product MBL fold metallo-hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene walJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088649.1 CDS 278976..281294 product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene adsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645787.1 CDS 281662..282141 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene rlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 CDS 282683..284428 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700190.1 CDS complement(284522..284974) product dihydrouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_14380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(285189..285944) product anion permease transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene tauE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355845.1 CDS complement(285944..286204) product persulfide-sensing transcriptional repressor CstR transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene cstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105088.1 CDS 286341..287408 product dihydroneopterin aldolase transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene cstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816133.1 CDS 287439..288773 product persulfide dioxygenase-sulfurtransferase CstB transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene cstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465472.1 CDS 288792..289985 product NAD(P)/FAD-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene sqr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033018.1 CDS complement(290652..291638) product tRNA-dihydrouridine synthase transl_table 11 codon_start 1 locus_tag LOCUS_14440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822528.1 CDS 292199..292495 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201644.1 CDS complement(292567..293787) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_14460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101031.1 CDS complement(293780..294331) product Flavodoxin_2 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_14470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 294444..295304 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 CDS complement(295659..296192) product DUF4865 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_14490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836457.1 CDS 296292..297026 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351709.1 CDS 297451..298062 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908956.1 CDS 298329..301481 product ATPase transl_table 11 codon_start 1 locus_tag LOCUS_14520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080564.1 CDS 301538..302020 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410567.1 CDS 302225..303211 product 1-phosphatidylinositol phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene plc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710555.1 CDS 303432..304202 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene csa1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977777.1 CDS 304254..305024 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_14560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977803.1 CDS 305088..305858 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_14570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977803.1 CDS 305925..306692 product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_14580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826312.1 CDS 306786..309023 product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840500.1 CDS 309174..310352 product amidohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_14600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075809.1 CDS 310354..311742 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_14610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006441.1 CDS complement(312235..313902) product Na/Pi cotransporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_14620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800966.1 CDS complement(314222..315997) product oleate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_14630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291840.1 CDS complement(316171..317043) product EamA family transporter transl_table 11 codon_start 1 locus_tag LOCUS_14640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038103.1 CDS 317156..318553 product PLP-dependent aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene norG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205592.1 CDS 318743..319216 product DUF1648 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_14660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036330.1 CDS 319478..321070 product L-lactate permease transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene lctP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173891.1 CDS complement(321399..322949) product staphylococcal protein A transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene spa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728765.1 CDS complement(323370..324122) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene sarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876756.1 CDS complement(324491..325489) product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene sirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136633.1 CDS complement(325486..326481) product staphyloferrin B ABC transporter permease subunit SirB transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene sirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924990.1 CDS complement(326497..327489) product staphyloferrin B ABC transporter substrate-binding protein SirA transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene sirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045111.1 CDS 327720..328700 product siderophore biosynthesis protein SbnA transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene sbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570808.1 CDS 328697..329707 product 2,3-diaminopropionate biosynthesis protein SbnB transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene sbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078461.1 CDS 329728..331482 product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene sbnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179385.1 CDS 331475..332731 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene sbnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610051.1 CDS 332721..334457 product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene sbnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179886.1 CDS 334438..336216 product IucA/IucC family siderophore biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene sbnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795344.1 CDS 336191..336967 product siderophore biosynthesis protein SbnG transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene sbnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186804.1 CDS 336967..338169 product diaminopimelate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene sbnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223713.1 CDS 338173..338937 product siderophore biosynthesis protein SbnI transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene sbnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015549.1 CDS 339133..339540 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_14820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 339590..340216 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_14830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414629.1 CDS 340428..341204 product diacetyl reductase ((S)-acetoin forming) transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene butA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183771.1 CDS 341549..342520 product NAD-dependent dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene galE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793242.1 CDS 342483..343175 product UDP-phosphate N-acetylgalactosaminyl-1-phosphate transferase transl_table 11 codon_start 1 locus_tag LOCUS_14860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736082.1 CDS 343385..344551 product glycosyltransferase family 1 protein transl_table 11 codon_start 1 locus_tag LOCUS_14870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692504.1 CDS 344532..345770 product O-antigen ligase family protein transl_table 11 codon_start 1 locus_tag LOCUS_14880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431230.1 CDS 345760..347190 product lipopolysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_14890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834089.1 CDS 347458..348057 product Superoxide dismutase [Mn/Fe] 2 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene sodM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874681.1 CDS 348425..349024 product cell-wall-anchored protein SasD transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene sasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731949.1 note frameshifted, insertion/deletion at around 348910 CDS 348915..349148 product Cell-wall-anchored protein SasD (LPXAG motif) transl_table 11 codon_start 1 locus_tag LOCUS_14920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 348910 CDS complement(349340..350080) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_14930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795345.1 CDS 350331..351038 product purine-nucleoside phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene deoD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 CDS 351045..352397 product tetracycline efflux MFS transporter Tet(38) transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene tet38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 sequence13 source 1..304735 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(110..619) product Asp23/Gls24 family envelope stress response protein transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene asp23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215236.1 CDS complement(682..921) product DUF2273 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_14970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002683.1 CDS complement(934..1470) product alkaline shock response membrane anchor protein AmaP transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene amaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825819.1 CDS complement(1645..3207) product glycine/betaine ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene opuD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792342.1 CDS complement(3514..4515) product zinc-binding alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_15000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781951.1 CDS complement(4749..5750) product NADP-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_15010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180222.1 CDS complement(6033..6902) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_15020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792547.1 CDS complement(7168..8580) product 6-phospho-beta-galactosidase transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene lacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169224.1 CDS complement(8598..10310) product PTS lactose EIICB component transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene lacE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983330.1 CDS complement(10316..10627) product lactose-specific phosphotransferase enzyme IIA component transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene lacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078309.1 CDS complement(10649..11629) product tagatose 1,6-diphosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene lacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047009.1 CDS complement(11633..12565) product tagatose-6-phosphate kinase transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene lacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604134.1 CDS complement(12578..13093) product galactose-6-phosphate isomerase subunit LacB transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene lacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CPH6 CDS complement(13109..13537) product galactose-6-phosphate isomerase subunit LacA transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene lacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRJ2 CDS complement(13905..14660) product DeoR/GlpR transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene lacR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795316.1 CDS 14911..15642 product NAD-dependent protein deacylase transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene cobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557494.1 CDS complement(15933..16541) product DUF3885 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_15120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181592.1 CDS complement(17148..17996) product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_15130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015500.1 CDS complement(18066..18482) product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_15140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850015.1 CDS 18890..21313 product hyaluronate lyase transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene hysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222267.1 CDS complement(21373..22227) product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_15160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044441.1 CDS complement(22438..23253) product hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_15170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044362.1 CDS 23547..23972 product toxin transl_table 11 codon_start 1 locus_tag LOCUS_15180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769705.1 CDS complement(24336..25040) product alpha-acetolactate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene budA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186134.1 CDS complement(25077..26741) product acetolactate synthase AlsS transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene alsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130149.1 CDS 27004..27213 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(27195..27377) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655241.1 CDS complement(27931..29337) product Conserved domain protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_15230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(29466..30602) product ATP-dependent Clp protease ATP-binding subunit transl_table 11 codon_start 1 locus_tag LOCUS_15240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(30603..31394) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(31407..31700) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 31699 CDS complement(31697..32794) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 32897,31699,33023 CDS complement(33339..33731) product 30S ribosomal protein S9 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene rpsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001790547.1 CDS complement(33751..34188) product 50S ribosomal protein L13 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene rplM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 CDS complement(34428..35231) product tRNA pseudouridine(38-40) synthase TruA transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene truA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221853.1 CDS complement(35236..36042) product energy-coupling factor transporter protein EcfT transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ecfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791620.1 CDS complement(36032..36892) product energy-coupling factor transporter ATPase transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene cbiO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155386.1 CDS complement(36889..37698) product energy-coupling factor transporter ATPase transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene cbiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389658.1 CDS complement(38236..38604) product 50S ribosomal protein L17 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene rplQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542274.1 CDS complement(38621..39565) product DNA-directed RNA polymerase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene rpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569649.1 CDS complement(39640..40029) product 30S ribosomal protein S11 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene rpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 CDS complement(40053..40418) product 30S ribosomal protein S13 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene rpsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 CDS complement(40586..40804) product translation initiation factor IF-1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene infA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 CDS complement(40997..41644) product adenylate kinase transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene adk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021468.1 CDS complement(41661..42953) product protein translocase subunit SecY transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene secY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616784.1 CDS complement(42953..43393) product 50S ribosomal protein L15 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene rplO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 CDS complement(43410..43589) product 50S ribosomal protein L30 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene rpmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 CDS complement(43606..44106) product 30S ribosomal protein S5 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene rpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 CDS complement(44127..44486) product 50S ribosomal protein L18 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene rplR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 CDS complement(44517..45053) product 50S ribosomal protein L6 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rplF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091975.1 CDS complement(45078..45476) product 30S ribosomal protein S8 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene rpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178881.1 CDS complement(45508..45693) product 30S ribosomal protein S14 type Z transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140799.1 CDS complement(45716..46255) product 50S ribosomal protein L5 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene rplE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 CDS complement(46282..46599) product 50S ribosomal protein L24 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rplX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 CDS complement(46635..47003) product 50S ribosomal protein L14 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene rplN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615921.1 CDS complement(47035..47298) product 30S ribosomal protein S17 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene rpsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004085.1 CDS complement(47322..47531) product 50S ribosomal protein L29 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene rpmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 CDS complement(47521..47955) product 50S ribosomal protein L16 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene rplP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 CDS complement(47958..48611) product 30S ribosomal protein S3 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene rpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529877.1 CDS complement(48635..48988) product 50S ribosomal protein L22 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene rplV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 CDS complement(49017..49295) product 30S ribosomal protein S19 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene rpsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 CDS complement(49362..50195) product 50S ribosomal protein L2 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rplB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985472.1 CDS complement(50228..50503) product 50S ribosomal protein L23 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene rplW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388082.1 CDS complement(50503..51126) product 50S ribosomal protein L4 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene rplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 CDS complement(51153..51815) product 50S ribosomal protein L3 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene rplC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160212.1 CDS complement(51843..52151) product 30S ribosomal protein S10 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene rpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 CDS 52508..52897 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788443.1 CDS complement(53089..54423) product NCS2 family permease transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene pbuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800700.1 CDS complement(54536..56671) product DNA topoisomerase III transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene topB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838479.1 CDS 56858..57745 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029536.1 CDS 57926..58789 product glucose uptake protein GlcU transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene glcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159898.1 CDS complement(59208..60116) product AEC family transporter transl_table 11 codon_start 1 locus_tag LOCUS_15670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445917.1 CDS 60249..60413 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051210.1 CDS 60658..60975 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene mspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161085.1 CDS complement(61162..64329) product AcrB/AcrD/AcrF family protein transl_table 11 codon_start 1 locus_tag LOCUS_15700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592307.1 CDS complement(64446..65711) product lipid II:glycine glycyltransferase FemX transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fmhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413862.1 CDS complement(66343..67107) product VOC family protein transl_table 11 codon_start 1 locus_tag LOCUS_15720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600967.1 CDS 67269..67709 product MarR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_15730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951058.1 CDS 67702..68913 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_15740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184404.1 CDS complement(69017..69367) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene sarV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066900.1 CDS 69493..69663 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792132.1 repeat_region 69723..69916 rpt_family CRISPR rpt_type direct rpt_unit_seq tgttggggccccgccaacttgca inference COORDINATES:alignment:CRT:1.2 CDS complement(70058..71080) product cyclic pyranopterin monophosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene moaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230173.1 CDS complement(71100..71699) product molybdenum cofactor guanylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene mobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643986.1 CDS complement(71706..71939) product molybdopterin synthase sulfur carrier subunit transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene moaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866971.1 CDS complement(71945..72391) product molybdopterin synthase catalytic subunit transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene moaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808495.1 CDS complement(72405..72890) product molybdopterin-guanine dinucleotide biosynthesis protein B transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene mobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602950.1 CDS complement(72887..74146) product molybdopterin molybdenumtransferase transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene moeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259717.1 tRNA complement(74355..74447) product cyclic pyranopterin monophosphate synthase MoaC locus_tag LOCUS_t00500 gene moaC inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(74705..75211) product molybdenum cofactor biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene moaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503822.1 CDS complement(75242..76246) product molybdopterin biosynthesis protein MoeB transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene moeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076930.1 CDS complement(76416..77021) product molybdenum ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene modC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913024.1 CDS complement(77022..77693) product molybdenum ABC transporter permease subunit transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene modB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113093.1 CDS complement(77707..78489) product molybdate ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene modA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782736.1 CDS 78779..79576 product sulfurtransferase FdhD transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene fdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030823.1 CDS complement(79748..80518) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_15890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146747.1 CDS complement(80590..81144) product biotin transporter BioY transl_table 11 codon_start 1 locus_tag LOCUS_15900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208742.1 CDS complement(81265..82206) product purine nucleosidase transl_table 11 codon_start 1 locus_tag LOCUS_15910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163416.1 CDS complement(82219..82407) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_15920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(82605..83513) product ferrichrome ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene fhuD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735038.1 CDS complement(83727..84881) product acyl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene ydbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999205.1 CDS complement(85098..85982) product urea transporter transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene yut inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800836.1 CDS 86263..86565 product urease subunit gamma transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene ureA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545928.1 CDS 86579..86989 product urease subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene ureB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612126.1 CDS 86986..88701 product urease subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene ureC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008673.1 CDS 88714..89166 product urease accessory protein UreE transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene ureE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634589.1 CDS 89159..89848 product urease accessory protein UreF transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene ureF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 CDS 89861..90475 product urease accessory protein UreG transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene ureG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002973.1 CDS 90475..91311 product urease accessory protein transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene ureD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344352.1 CDS complement(91500..91847) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene sarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036076.1 CDS complement(92275..92601) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599589.1 CDS complement(92665..93408) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032848.1 CDS complement(93434..95389) product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131842.1 CDS 95999..96802 product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene ssaA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717381.1 CDS complement(96819..97061) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789136.1 CDS complement(97235..98635) product Na+/H+ antiporter NhaC transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene nhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977739.1 CDS complement(98730..99812) product octopine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_16100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 CDS 100060..100482 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_16110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206114.1 CDS 100719..101219 product Secretory antigen SsaA transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene ssaA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737705.1 CDS 101581..102534 product 2-hydroxyacid dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene pdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417018.1 CDS complement(102626..103750) product NAD(P)-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_16140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 CDS complement(104061..104837) product N-acetylmuramoyl-L-alanine amidase transl_table 11 codon_start 1 locus_tag LOCUS_16150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447058.1 CDS complement(104859..105110) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_16160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921246.1 CDS complement(105320..105793) product DUF1641 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840811.1 CDS complement(105793..108747) product formate dehydrogenase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene fdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155278.1 CDS complement(109349..110296) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792529.1 CDS complement(110429..111226) product inositol monophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_16200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130454.1 CDS 111611..112303 product YafY family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030125.1 CDS 112659..112973 product transporter transl_table 11 codon_start 1 locus_tag LOCUS_16220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 112856 CDS complement(112950..113687) product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene spdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426696.1 CDS 113736..114065 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606726.1 CDS 114510..115382 product MurR/RpiR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene rpiRc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073195.1 CDS complement(115769..117148) product alanine glycine permease transl_table 11 codon_start 1 locus_tag LOCUS_16260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429674.1 CDS 117428..117784 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917669.1 CDS 117781..117966 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205307.1 CDS complement(118062..118253) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971980.1 CDS complement(118264..118899) product haloacid dehalogenase transl_table 11 codon_start 1 locus_tag LOCUS_16300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285450.1 CDS complement(118974..119891) product sodium transporter transl_table 11 codon_start 1 locus_tag LOCUS_16310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 CDS 120158..120688 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904065.1 CDS complement(120754..122358) product PTS system, arbutin-like IIBC component transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene glvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991504.1 CDS 122688..123452 product MurR/RpiR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene glvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477989.1 CDS complement(123510..124016) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051556.1 CDS complement(124183..125496) product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_16360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451828.1 CDS complement(125721..126290) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185190.1 CDS complement(126777..127658) product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_16380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235289.1 CDS complement(127769..128890) product amidohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_16390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523157.1 CDS complement(129167..130405) product imidazolonepropionase transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene hutI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998753.1 CDS complement(130405..132066) product urocanate hydratase transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene hutU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 CDS 132226..133110 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene hutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691839.1 assembly_gap 133182..133286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 133455..133874 product metallothiol transferase FosB transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene fosB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920239.1 CDS complement(134130..135065) product formimidoylglutamase transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene hutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277968.1 CDS 135355..136614 product CPBP family intramembrane metalloprotease SdpC transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene sdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794442.1 CDS complement(136680..137366) product Ribose-5-phosphate isomerase A transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene rpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655864.1 CDS 137540..138193 product MOSC domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623440.1 CDS complement(138429..139448) product galactose mutarotase transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene galM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634677.1 CDS complement(139478..139804) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_16490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966695.1 CDS complement(139853..140038) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789152.1 CDS complement(140022..141254) product sodium ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_16510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548702.1 CDS complement(141247..142146) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_16520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 CDS complement(142377..143024) product DUF805 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436823.1 CDS 143423..144031 product DNA-3-methyladenine glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene aag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348300.1 CDS 144368..145576 product sodium/glutamate symporter transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene gltS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571591.1 CDS complement(145624..146673) product type 2 isopentenyl-diphosphate Delta-isomerase transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene fni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279375.1 CDS complement(146704..147651) product cobalt transporter CorA transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene corA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185431.1 CDS 147706..148239 product thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_16580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234727.1 CDS 148236..148655 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128655.1 CDS complement(148763..149683) product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_16600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620864.1 CDS 149891..150529 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184229.1 CDS complement(150775..152706) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene emrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213885.1 CDS complement(152719..153366) product HlyD family secretion protein transl_table 11 codon_start 1 locus_tag LOCUS_16630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738250.1 CDS 153487..154038 product TetR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828569.1 CDS complement(154268..155476) product Bcr/CflA family drug resistance efflux transporter transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene tcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999131.1 CDS complement(155745..157127) product zinc ribbon domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833794.1 CDS complement(157367..157504) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(157586..157822) product HTH marR-type domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 158017..158985 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_16690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549718.1 CDS 159560..159916 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(160056..160721) product hemin ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene hrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229920.1 CDS complement(160721..161776) product hemin ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene hrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761395.1 CDS 161912..162586 product DNA-binding heme response regulator HssR transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene hssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249497.1 CDS 162579..163952 product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene hssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477338.1 CDS 164115..164558 product LytTR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977032.1 CDS 164555..165010 product DUF3021 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 CDS complement(165076..166554) product malate:quinone oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene mqo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211366.1 CDS complement(166935..168533) product L-lactate permease transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene lctP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960858.1 CDS 168850..170523 product CDP-glycerol glycerophosphotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_16790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595297.1 CDS complement(170676..171305) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827010.1 CDS complement(171619..172134) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene paiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907311.1 CDS 172325..173329 product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_16820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792518.1 CDS complement(173375..173776) product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_16830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557510.1 CDS complement(173812..174846) product ferredoxin--NADP(+) reductase transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene iruO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655971.1 CDS complement(175078..175509) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_16850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253464.1 CDS complement(175716..176993) product phage infection protein transl_table 11 codon_start 1 locus_tag LOCUS_16860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020016.1 CDS 177154..177777 product TetR/AcrR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656771.1 CDS 177823..178767 product magnesium transporter CorA transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene corA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633068.1 CDS complement(178853..180295) product PTS sucrose transporter subunit IIBC transl_table 11 codon_start 1 locus_tag LOCUS_16890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108116.1 CDS 180478..180861 product YbgA family protein transl_table 11 codon_start 1 locus_tag LOCUS_16900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664359.1 CDS 182349..184454 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene rsp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128366.1 CDS 184525..184947 product pyridoxamine 5'-phosphate oxidase family protein transl_table 11 codon_start 1 locus_tag LOCUS_16920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071904.1 CDS 185212..185568 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene narK_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727328.1 CDS complement(185972..187249) product Proton/sodium-glutamate symport protein transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene gltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173165.1 CDS complement(187431..187796) product DUF3139 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_16950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727537.1 CDS 188194..188640 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene sarZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289215.1 CDS 188862..189284 product Hsp20/alpha crystallin family protein transl_table 11 codon_start 1 locus_tag LOCUS_16970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797427.1 CDS complement(189391..190560) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene narK_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278556.1 CDS 190930..191568 product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_16990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 191638..191844 product DUF2268 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 191823..192563 product MerR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_17010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332063.1 CDS complement(192821..193474) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene nreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 CDS complement(193497..194531) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene nreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606546.1 CDS complement(194555..195007) product GAF domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene nreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186933.1 CDS complement(195027..195704) product nitrate reductase subunit gamma transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene narI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 CDS complement(195697..196272) product nitrate reductase molybdenum cofactor assembly chaperone transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene narJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795300.1 CDS complement(196265..197824) product nitrate reductase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene narH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692648.1 CDS complement(197814..201503) product nitrate reductase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene narG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514408.1 CDS complement(201812..202789) product uroporphyrinogen-III C-methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene cobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109877.1 CDS complement(202780..203094) product nitrite reductase (NAD(P)H) small subunit transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene nasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448224.1 CDS complement(203098..205503) product nitrite reductase large subunit transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene nasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118725.1 CDS complement(205569..206300) product cobalamin biosynthesis protein CbiX transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene nirR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014063.1 CDS complement(206530..207066) product GNAT family N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_17130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169317.1 CDS complement(207299..208123) product formate/nitrite transporter transl_table 11 codon_start 1 locus_tag LOCUS_17140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572038.1 CDS complement(208340..208522) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230292.1 CDS complement(208606..209073) product glutathione S-transferase transl_table 11 codon_start 1 locus_tag LOCUS_17160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153347.1 CDS complement(209259..210809) product zinc ABC transporter substrate-binding lipoprotein AdcA transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene adcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727772.1 CDS complement(211104..211370) product Txe/YoeB family addiction module toxin transl_table 11 codon_start 1 locus_tag LOCUS_17180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 CDS complement(211370..211621) product prevent-host-death protein transl_table 11 codon_start 1 locus_tag LOCUS_17190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584499.1 CDS complement(211894..212493) product protein disulfide-isomerase transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene dsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162810.1 CDS complement(212512..212874) product cystatin-like fold lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_17210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819843.1 CDS 213129..214379 product aminoacyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene fmhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012225.1 CDS complement(214476..215207) product amino acid ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615461.1 CDS complement(215204..215923) product amino acid ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene tcyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479576.1 CDS complement(215904..216683) product amino acid ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene tcyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825921.1 CDS complement(216804..218243) product drug:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene mdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072416042.1 CDS complement(218675..219361) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene gpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125208.1 CDS complement(219688..220554) product cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_17280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019127.1 CDS 221306..222616 product immunoglobulin-binding protein sbi transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene sbi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792559.1 CDS complement(222556..222735) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031763544.1 CDS 223152..224081 product gamma-hemolysin component A transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene hlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594519.1 CDS 224649..225596 product bi-component gamma-hemolysin HlgCB subunit C transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene hlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916704.1 CDS 225598..226575 product gamma-hemolysin component B transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene hlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783428.1 CDS complement(226627..227094) product Putative membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_17340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200956.1 CDS complement(227105..227797) product 6-carboxyhexanoate--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene bioW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286875.1 CDS complement(227808..228923) product 8-amino-7-oxononanoate synthase transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene bioF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971550.1 CDS complement(228901..229908) product biotin synthase transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene bioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046645.1 CDS complement(229910..231268) product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene bioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110061.1 CDS complement(231246..231932) product dethiobiotin synthase transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene bioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217926.1 CDS complement(232384..234117) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486487.1 CDS complement(234142..235905) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064825.1 CDS 236537..236743 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(236774..237160) product GtrA family protein transl_table 11 codon_start 1 locus_tag LOCUS_17430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779360.1 CDS 237428..238570 product glycerate kinase transl_table 11 codon_start 1 locus_tag LOCUS_17440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176863.1 CDS 238630..239289 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_17450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831298.1 CDS 239471..240682 product Bcr/CflA family drug resistance efflux transporter transl_table 11 codon_start 1 locus_tag LOCUS_17460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192075.1 CDS complement(240805..241278) product AraC family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_17470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456486.1 CDS 241391..242047 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080281.1 CDS complement(242110..242916) product phosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_17490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690200.1 CDS 243203..244612 product alanine glycine permease transl_table 11 codon_start 1 locus_tag LOCUS_17500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101538.1 CDS 244750..246828 product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_17510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185695.1 CDS complement(246968..248797) product amino acid permease transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene kimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483052.1 CDS 249029..250525 product protein flp transl_table 11 codon_start 1 locus_tag LOCUS_17530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208563.1 CDS complement(250617..251468) product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_17540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034497.1 CDS complement(251790..252725) product 2-dehydropantoate 2-reductase transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene panE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684060.1 CDS complement(252951..254351) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_17560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381269.1 CDS complement(254645..255340) product amino acid ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene opuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398941.1 CDS complement(255340..256281) product amino acid transporter transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene opuCC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721551.1 CDS complement(256298..256933) product choline ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene opuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569120.1 CDS complement(256930..258156) product glycine/betaine ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene opuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948974.1 CDS complement(258826..259425) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291519.1 CDS complement(259418..259618) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071621408.1 CDS 259605..261242 product amino acid:proton symporter transl_table 11 codon_start 1 locus_tag LOCUS_17630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030720.1 CDS 261850..263202 product Carboxylic ester hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene pnbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700925.1 CDS complement(263264..264451) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_17650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026189.1 CDS complement(264847..265623) product iron export ABC transporter permease subunit FetB transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene fetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072149.1 CDS complement(265616..266278) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923526.1 CDS complement(266526..267602) product peptidase M28 transl_table 11 codon_start 1 locus_tag LOCUS_17680 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 CDS complement(267957..268223) product Txe/YoeB family addiction module toxin transl_table 11 codon_start 1 locus_tag LOCUS_17690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074049.1 CDS complement(268223..268480) product prevent-host-death protein transl_table 11 codon_start 1 locus_tag LOCUS_17700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 CDS complement(268586..268780) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 268839..269294 product DUF1307 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732076.1 CDS complement(269462..271039) product FMN-binding glutamate synthase family protein transl_table 11 codon_start 1 locus_tag LOCUS_17730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143494.1 CDS 271234..271983 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene lnsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072461.1 CDS complement(272207..273400) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_17750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675401.1 CDS complement(273412..274161) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene cntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598772.1 CDS complement(274154..274969) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene cntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 CDS complement(274966..275835) product nickel ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene cnzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584759.1 CDS complement(275832..276767) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_17790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472243.1 CDS complement(276780..278378) product staphylopine-dependent metal ABC transporter substrate-binding protein CntA transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene cntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229087.1 CDS complement(278521..279822) product staphylopine dehydrogenase CntM transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene cntM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040588.1 CDS complement(279815..280633) product D-histidine (S)-2-aminobutanoyltransferase CntL transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene cntL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058848.1 CDS complement(280644..281465) product diaminopimelate epimerase transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene cntK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081693.1 CDS complement(282332..282697) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(282960..283679) product short-chain dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene lvr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824948.1 CDS 284011..285549 product transporter transl_table 11 codon_start 1 locus_tag LOCUS_17860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202034.1 CDS complement(285661..286083) product carboxymuconolactone decarboxylase family protein transl_table 11 codon_start 1 locus_tag LOCUS_17870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146763.1 CDS complement(286535..286954) product DUF1433 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034766.1 CDS complement(286972..287391) product DUF1433 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038240.1 CDS complement(287658..288080) product DUF1433 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_17900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034758.1 CDS complement(288331..289026) product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_17910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217456.1 CDS 289315..289596 product single-stranded DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_17920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220938.1 CDS 289532..289717 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791851.1 CDS complement(289856..290047) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224379.1 CDS complement(290608..291402) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_17950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581894.1 CDS complement(291938..292225) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521959.1 CDS complement(292228..292554) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_17970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495498.1 CDS complement(292554..292835) product Insertion sequenceATP-binding protein, putative transl_table 11 codon_start 1 locus_tag LOCUS_17980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 292849 CDS complement(292766..293878) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_17990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044255.1 note frameshifted, insertion/deletion at around 292846 CDS complement(293875..294585) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_18000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581894.1 CDS complement(294772..295473) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_18010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972657.1 CDS complement(295851..297350) product helicase transl_table 11 codon_start 1 locus_tag LOCUS_18020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(297393..298712) product helicase transl_table 11 codon_start 1 locus_tag LOCUS_18030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS complement(298714..299106) product (deoxy)nucleoside triphosphate pyrophosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_18040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755946.1 CDS 299394..301031 product phospho-sugar mutase transl_table 11 codon_start 1 locus_tag LOCUS_18050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835549.1 CDS 301315..301581 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678764.1 CDS 301725..302033 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217714.1 CDS complement(302141..302311) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(302355..303548) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_18090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353352.1 sequence14 source 1..185223 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 148..1326 product phosphopentomutase transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene deoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197806.1 CDS complement(1457..2272) product phosphonate ABC transporter, permease protein PhnE transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene phnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191092.1 CDS complement(2269..3069) product phosphonate ABC transporter, permease protein PhnE transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene phnE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127689.1 CDS complement(3071..3844) product phosphonates import ATP-binding protein PhnC transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene phnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 CDS complement(4058..5014) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787777.1 CDS 5243..6787 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725608.1 CDS 6838..8373 product bifunctional metallophosphatase/5'-nucleotidase transl_table 11 codon_start 1 locus_tag LOCUS_18160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065030.1 CDS 8466..8660 product Transcription regulator transl_table 11 codon_start 1 locus_tag LOCUS_18170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 9033..9518 product replication initiation protein transl_table 11 codon_start 1 locus_tag LOCUS_18180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 9446 CDS 9503..9793 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 9446 CDS 9976..10164 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator assembly_gap 10457..10503 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10864..11085 product IS200/IS605 family transposase transl_table 11 codon_start 1 locus_tag LOCUS_18210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 10855 note possible pseudo due to internal stop codon CDS 11535..14144 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene adhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955781.1 CDS 14489..15157 product capsular polysaccharide type 5 biosynthesis protein cap5A transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene capA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446299.1 CDS 15173..15859 product capsular polysaccharide biosynthesis protein Cap5B transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene capB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037332.1 CDS 15862..16626 product capsular polysaccharide biosynthesis protein Cap8C transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene capC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565304.1 CDS 16646..18469 product polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene capD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940790.1 CDS 18459..19487 product NAD-dependent epimerase/dehydratase family protein transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene capE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459062.1 CDS 19500..20609 product capsular polysaccharide biosynthesis protein Cap8F transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene capF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028283.1 CDS 20613..21737 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene capG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 CDS 21740..22366 product O-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene capH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216898.1 CDS 22371..23480 product capsular polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene capI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 CDS 23494..24660 product capsular polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene capJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668175.1 CDS 24653..25858 product capsular polysaccharide biosynthesis protein transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene capK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239647.1 CDS 25859..27064 product glycosyltransferase WbuB transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene capL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291020.1 CDS 27075..27632 product sugar transferase transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene capM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 CDS 27632..28519 product UDP-glucose 4-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene capN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230679.1 CDS 28573..29835 product UDP-N-acetyl-D-mannosamine dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene capO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 CDS 29912..31057 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) transl_table 11 codon_start 1 locus_tag LOCUS_18380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723436.1 CDS complement(31122..31448) product monooxygenase IsdI transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene isdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480603.1 CDS complement(31455..31838) product DUF454 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237004.1 CDS 32265..33752 product aldehyde dehydrogenase family protein transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene aldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290397.1 CDS 34398..35357 product cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_18420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 CDS complement(35419..35622) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356963.1 CDS 35801..36313 product DUF4242 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 CDS 36655..37395 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590854.1 CDS 37409..38383 product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826669.1 CDS 38380..39141 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene ssuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197961.1 CDS 39154..40185 product acyl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171645.1 CDS 40402..40761 product DUF2294 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092004.1 CDS 40934..41959 product formate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene fdh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706135.1 CDS 42345..43595 product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_18510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826862.1 CDS 44042..51217 product non-ribosomal peptide synthetase transl_table 11 codon_start 1 locus_tag LOCUS_18520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605281.1 CDS 51230..51874 product 4'-phosphopantetheinyl transferase transl_table 11 codon_start 1 locus_tag LOCUS_18530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215722.1 CDS complement(52202..52696) product YagU family protein transl_table 11 codon_start 1 locus_tag LOCUS_18540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822554.1 CDS complement(52951..53715) product acetylglutamate kinase transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene argB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668894.1 CDS complement(53731..54972) product bifunctional glutamate N-acetyltransferase/amino-acid N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene argJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682619.1 CDS complement(54984..56015) product N-acetyl-gamma-glutamyl-phosphate reductase transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene argC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598482.1 CDS complement(56054..57238) product ornithine aminotransferase 1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene argD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084442.1 CDS complement(57491..58846) product branched-chain amino acid transport system II carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene brnQ_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728170.1 CDS complement(59122..59619) product isochorismatase family protein transl_table 11 codon_start 1 locus_tag LOCUS_18600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557561.1 CDS complement(59746..61386) product indolepyruvate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene ipdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813525.1 CDS complement(61660..63705) product PTS glucose EIICBA component transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene glcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227709.1 CDS 64291..65346 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene mupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835000.1 CDS 65343..66242 product N-acetylmuramic acid 6-phosphate etherase transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene murQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432017.1 CDS 66254..67708 product permease transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene murP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159750.1 CDS 67711..68586 product MurR/RpiR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene murR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181832.1 CDS 69274..69864 product Type I site-specific deoxyribonuclease transl_table 11 codon_start 1 locus_tag LOCUS_18670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 69958..72063 product type-1 restriction enzyme R protein transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene hsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331330.1 note possible pseudo due to internal stop codon CDS 72268..73110 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 CDS 73112..74035 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_18700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321154.1 CDS 74022..75134 product RES domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_18710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(75399..76991) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067352.1 CDS 77746..78426 product ABC transporter, permease protein transl_table 11 codon_start 1 locus_tag LOCUS_18730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 78432..79595 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_18740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240113.1 CDS 79612..81387 product peptide ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720816.1 CDS 81425..83431 product gamma-glutamyltranspeptidase transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ggt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236427.1 CDS complement(83729..84502) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_18770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643619.1 CDS complement(84692..85318) product FMN-dependent NADH-azoreductase transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene azoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151451.1 CDS 85527..86105 product peptidase M23 transl_table 11 codon_start 1 locus_tag LOCUS_18790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166920.1 CDS 86488..87585 product sugar ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene malK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818915.1 CDS 87598..88869 product maltose ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene malE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034961.1 CDS 88872..90140 product maltose ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene malF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166892.1 CDS 90142..90981 product maltose ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_18830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 CDS 91055..92131 product gfo/Idh/MocA family oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_18840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 CDS 92156..93196 product gfo/Idh/MocA family oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_18850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163820.1 CDS 93251..94219 product xylose isomerase transl_table 11 codon_start 1 locus_tag LOCUS_18860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 CDS complement(94580..95074) product isoprenylcysteine carboxyl methyltransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_18870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794523.1 CDS 95307..96686 product hexose phosphate transporter transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene uhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008722.1 CDS complement(97045..97803) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene hptR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477526.1 CDS complement(97796..99352) product sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene hptS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127990.1 CDS complement(99349..100317) product lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene hptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837116.1 CDS 100905..103154 product formate acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene pflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894660.1 CDS 103177..103932 product pyruvate formate-lyase-activating enzyme transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene pflA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911657.1 CDS 104268..106031 product glycerophosphoryl diester phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_18940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822589.1 CDS complement(106195..106539) product complement inhibitor SCIN family protein transl_table 11 codon_start 1 locus_tag LOCUS_18950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211597.1 CDS 106729..108639 product coagulase transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene coa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744096.1 CDS complement(109243..110427) product thiolase family protein transl_table 11 codon_start 1 locus_tag LOCUS_18970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154619.1 CDS complement(110457..112718) product 3-hydroxyacyl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene fadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154537.1 CDS complement(112904..114115) product glutaryl-CoA dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene fadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142199.1 CDS complement(114227..115732) product long-chain-fatty-acid--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene fadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008400.1 CDS complement(115758..117320) product acyl CoA:acetate/3-ketoacid CoA transferase transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene fadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795358.1 CDS 117689..118918 product PrsW family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_19020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922818.1 CDS complement(119232..120644) product nickel ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene opp-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556251.1 CDS complement(120905..121261) product DUF488 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215216.1 CDS complement(121418..121591) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773989.1 CDS complement(121617..122762) product nitric oxide dioxygenase transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene hmp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954799.1 CDS 123335..124288 product L-lactate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene lctE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031880.1 CDS complement(124608..126137) product PTS glucose transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene glcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 CDS 126499..127434 product nucleoside hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_19090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823221.1 CDS 127773..129869 product transcriptional antiterminator transl_table 11 codon_start 1 locus_tag LOCUS_19100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012737.1 CDS 129854..130321 product PTS sugar transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_19110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531476.1 CDS 130344..130622 product PTS galactitol transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_19120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815795.1 CDS 130849..132108 product PTS galactitol transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene gatC_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120109.1 CDS 132126..133181 product alcohol dehydrogenase catalytic domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646211.1 CDS 133183..133329 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230358.1 CDS 133353..134396 product galactitol-1-phosphate 5-dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_19160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645608.1 CDS 134924..135640 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene tarI' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638475.1 CDS 135633..136658 product alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene tarJ' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610180.1 CDS 136680..138374 product tagB protein transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene tarL' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031898830.1 CDS 138802..139971 product CDP-glycerol--glycerophosphate glycerophosphotransferase transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene tarF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594817.1 CDS 140247..140963 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene tarI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872486.1 CDS 140956..141981 product ribitol-5-phosphate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene tarJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 CDS 142003..143691 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene tarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240920.1 CDS 143724..145448 product glycosyltransferase family 2 protein transl_table 11 codon_start 1 locus_tag LOCUS_19240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 CDS 145588..146262 product iron-sulfur cluster repair protein ScdA transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene scdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608818.1 CDS 146509..148263 product Autolysin sensor kinase transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene lytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925394.1 CDS 148266..149006 product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene lytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645452.1 CDS 149125..149562 product antiholin-like protein LrgA transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene lrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792906.1 CDS 149555..150256 product antiholin-like protein LrgB transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene lrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607067.1 CDS complement(150364..151068) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene bglR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922320.1 CDS 151217..152008 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066931.1 CDS 152024..153460 product 6-phospho-beta-glucosidase transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene bglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164003.1 CDS complement(153893..154654) product SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031262.1 CDS complement(154905..155819) product ribokinase transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene rbsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182746.1 CDS complement(155847..156251) product D-ribose pyranase transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rbsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747873.1 CDS complement(156266..157147) product ribose transporter RbsU transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rbsU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029196.1 CDS complement(157379..158377) product LacI family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene rbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757880.1 CDS 158528..158707 product NADH dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_19380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792075.1 CDS 158757..159149 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159765.1 CDS 159377..159781 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_19400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(159822..161198) product MFS transporter transl_table 11 codon_start 1 locus_tag LOCUS_19410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066548.1 CDS 161432..162424 product linear amide C-N hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_19420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337368.1 CDS 162750..163700 product glycyl-glycine endopeptidase LytM transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene lytM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736784.1 CDS complement(163752..164411) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_19440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570070.1 CDS complement(164425..165345) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_19450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806102.1 CDS complement(165342..166508) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_19460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848761.1 CDS complement(166576..168099) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038527.1 CDS 168370..169023 product DUF5079 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 169057..169644 product DUF5080 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(169787..170680) product CHAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751215.1 CDS 170928..171221 product virulence factor EsxA transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene esxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240826.1 CDS 171305..174334 product type VII secretion protein EsaA transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene esaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728958.1 CDS 174334..174792 product protein EssA transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene essA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928938.1 CDS 174764..175006 product type VII secretion protein EsaB transl_table 11 codon_start 1 locus_tag LOCUS_19540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011446982.1 CDS 175019..176353 product protein EssB transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene essB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240338.1 CDS 176375..176530 product FtsK_SpoIIIE_N domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo due to internal stop codon CDS 176558..180814 product protein EssC transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene essC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549287.1 CDS 180844..181236 product protein EsaC transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene esxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010292.1 CDS 181252..181566 product virulence factor EsxB transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene esxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509671.1 CDS 181566..182240 product DUF5081 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene esaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655881.1 CDS 182246..182557 product Type VII secretion system extracellular protein D transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene esxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175722.1 CDS 182567..184411 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene esaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159018.1 CDS 184422..184913 product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene esaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142044.1 sequence15 source 1..158438 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(765..1361) product recombination protein RecR transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene recR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559159.1 CDS complement(1368..1685) product YbaB/EbfC family nucleoid-associated protein transl_table 11 codon_start 1 locus_tag LOCUS_19650 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213992.1 CDS complement(1775..3472) product DNA polymerase III subunit gamma/tau transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene dnaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109040.1 CDS complement(3541..4065) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167828.1 CDS complement(4704..5432) product trehalose operon repressor transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene treR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118675.1 CDS complement(5457..7097) product glucohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene treC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031490.1 CDS complement(7161..8588) product PTS ascorbate transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene treP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279361.1 tRNA complement(9059..9151) product tRNA-Ser locus_tag LOCUS_t00510 inference COORDINATES:profile:Aragorn:1.2.38 CDS complement(9420..10883) product glutamate synthase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene gltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503590.1 CDS complement(10901..15400) product glutamate synthase large subunit transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene gltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551342.1 CDS 15581..16465 product LysR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene gltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403915.1 CDS 16586..17698 product YibE/F family protein transl_table 11 codon_start 1 locus_tag LOCUS_19740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794550.1 CDS 17695..18477 product YibE/F family protein transl_table 11 codon_start 1 locus_tag LOCUS_19750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994678.1 CDS complement(18646..19131) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_19760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183668.1 CDS complement(19121..19516) product DNA mismatch repair protein MutT transl_table 11 codon_start 1 locus_tag LOCUS_19770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588522.1 CDS 19665..19934 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129473.1 CDS complement(20119..21123) product N-acetylmuramoyl-L-alanine amidase transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene sle1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170264.1 CDS complement(21455..22297) product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene gmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825530.1 CDS complement(22334..22993) product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene gmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 CDS complement(22997..24022) product methionine import ATP-binding protein MetN 1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene gmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569281.1 CDS complement(24316..25458) product cystathionine gamma-synthase transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene mccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036648.1 CDS complement(25442..26356) product cysteine synthase transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene mccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634098.1 CDS complement(26573..27910) product sodium-dependent transporter transl_table 11 codon_start 1 locus_tag LOCUS_19850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828719.1 CDS complement(28366..29100) product carboxylesterase transl_table 11 codon_start 1 locus_tag LOCUS_19860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220811.1 CDS complement(29137..29811) product phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_19870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565813.1 CDS complement(30494..30856) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene mpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 CDS complement(31018..33723) product Probable inorganic carbon transporter subunit DabA transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene dabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211545.1 CDS complement(33736..35220) product NADH dehydrogenase subunit 5 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene ndhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948295.1 CDS complement(36809..38011) product GTP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene zagA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 CDS 38196..38390 product Membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_19920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797248.1 CDS complement(38680..38994) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172535.1 CDS complement(39013..39336) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_19940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971497.1 CDS complement(39333..40658) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_19950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653707.1 CDS complement(40651..41388) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_19960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540879.1 CDS complement(41646..42431) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene lpl8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835971.1 CDS complement(42450..43268) product tandem-type lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_19980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540323.1 CDS 43606..43914 product myeloperoxidase inhibitor SPIN transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene spn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669519.1 CDS complement(44018..45526) product FKLRK protein transl_table 11 codon_start 1 locus_tag LOCUS_20000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208917.1 CDS complement(45548..46225) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene ssl11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769160.1 CDS complement(46608..47819) product restriction endonuclease subunit S transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene hsdS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 CDS complement(47812..49302) product type I restriction-modification system subunit M transl_table 11 codon_start 1 locus_tag LOCUS_20030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028663.1 assembly_gap 48763..48894 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49566..50249) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene ssl10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673051.1 CDS complement(50615..51313) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene ssl9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778500.1 CDS complement(51693..52391) product superantigen-like protein SSL8 transl_table 11 codon_start 1 locus_tag LOCUS_20060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673034.1 CDS complement(52735..53430) product superantigen-like protein SSL7 transl_table 11 codon_start 1 locus_tag LOCUS_20070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769820.1 CDS complement(53851..54546) product Exotoxin transl_table 11 codon_start 1 locus_tag LOCUS_20080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(54992..55696) product superantigen-like protein SSL5 transl_table 11 codon_start 1 locus_tag LOCUS_20090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781349.1 CDS complement(56060..56986) product superantigen-like protein SSL4 transl_table 11 codon_start 1 locus_tag LOCUS_20100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705657.1 CDS complement(57351..58421) product superantigen-like protein SSL3 transl_table 11 codon_start 1 locus_tag LOCUS_20110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056483.1 CDS complement(58712..59407) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene ssl2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782622.1 CDS complement(59693..60373) product superantigen-like protein SSL1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669014.1 CDS 60845..61690 product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024371.1 CDS 61709..62068 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_20150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021623.1 CDS 62592..62744 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248844.1 CDS 63005..63277 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_20170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159787.1 CDS 63676..64380 product MazF/PemK family toxin transl_table 11 codon_start 1 locus_tag LOCUS_20180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041880.1 CDS 64773..65309 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551643.1 CDS complement(65422..66963) product GMP synthase (glutamine-hydrolyzing) transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene guaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424963.1 CDS complement(66988..68454) product IMP dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene guaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264071.1 CDS complement(68492..69760) product xanthine permease transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene pbuX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793018.1 CDS complement(69760..70338) product xanthine phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene xpt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421410.1 CDS 70851..71258 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763767.1 CDS 71401..72063 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394698.1 CDS 72181..73137 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956137.1 CDS 74114..75502 product L-cystine transporter transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991018.1 CDS complement(75583..76338) product NADPH-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene nfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287099.1 CDS 76830..77399 product alkyl hydroperoxide reductase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene ahpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052781.1 CDS 77415..78938 product alkyl hydroperoxide reductase subunit F transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene ahpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930514.1 CDS 79053..79310 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 79383..80009 product NDxxF motif lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_20320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746679.1 CDS 80264..80647 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868259.1 CDS complement(80713..81294) product histidine phosphatase family protein transl_table 11 codon_start 1 locus_tag LOCUS_20340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158375.1 CDS 81472..81681 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211677.1 CDS complement(81720..81971) product GlsB/YeaQ/YmgE family stress response membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_20360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466748.1 CDS 82271..82534 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_20370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055897.1 CDS complement(82672..83244) product peptidase transl_table 11 codon_start 1 locus_tag LOCUS_20380 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769722.1 CDS complement(83425..83793) product DUF1093 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene yxeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849163.1 CDS complement(84162..84773) product toxin transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene selX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475325.1 CDS 85133..85291 product integrase transl_table 11 codon_start 1 locus_tag LOCUS_20410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 85369..85680 product integrase transl_table 11 codon_start 1 locus_tag LOCUS_20420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 85683..86657 product Abi family protein transl_table 11 codon_start 1 locus_tag LOCUS_20430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817700.1 CDS complement(86923..87165) product 30S ribosomal protein S18 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene rpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897044.1 CDS complement(87217..87720) product single-stranded DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene ssb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934799.1 CDS complement(87741..88037) product 30S ribosomal protein S6 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene rpsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261460.1 CDS 88281..88472 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052484.1 CDS complement(88558..89655) product GTP-binding protein YchF transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene ychF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218732.1 CDS complement(89667..89870) product DUF951 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157348.1 CDS complement(89900..90781) product mechanosensitive ion channel protein MscS transl_table 11 codon_start 1 locus_tag LOCUS_20500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373073.1 CDS complement(90938..91774) product chromosome partitioning protein ParB transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene parB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557587.1 CDS 92447..93550 product cystathionine gamma-synthase transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene metI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655692.1 CDS 93547..94707 product cystathionine beta-lyase transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene metC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175854.1 CDS 94676..96517 product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene metF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077317.1 CDS 96514..98742 product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene metE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207623.1 CDS 98785..99537 product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene mdh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 CDS complement(99620..100801) product acetyl-CoA C-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199066.1 CDS 101340..102473 product Low temperature requirement protein LtrA transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene ltrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245682.1 CDS complement(102840..103469) product ABC-2 transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_20590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677725.1 CDS complement(103469..104311) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_20600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209551.1 CDS complement(104336..105049) product DUF3169 family protein transl_table 11 codon_start 1 locus_tag LOCUS_20610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698749.1 CDS complement(105046..105249) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_20620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246008.1 CDS 105490..105879 product DUF1398 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_20630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886004.1 CDS 105988..106203 product Sec-independent protein translocase protein TatA transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene tatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794540.1 CDS 106316..106921 product twin-arginine translocase subunit TatC transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene tatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922821.1 CDS complement(107014..108726) product FTR1 family iron permease transl_table 11 codon_start 1 locus_tag LOCUS_20660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822764.1 CDS complement(108707..109936) product deferrochelatase/peroxidase EfeB transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene fepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186223.1 CDS complement(109933..110787) product EfeM/EfeO family lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene fepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737196.1 CDS complement(111055..111600) product RimJ/RimL family protein N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_20690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 CDS complement(111613..112020) product Nitrogen regulation protein NIFR3 transl_table 11 codon_start 1 locus_tag LOCUS_20700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093031.1 CDS 112019..113014 product YeiH family putative sulfate export transporter transl_table 11 codon_start 1 locus_tag LOCUS_20710 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157630.1 CDS complement(113074..113640) product NAD(P)H-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028429.1 CDS complement(113654..114715) product LLM class flavin-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096113.1 CDS complement(114729..115655) product glyoxalase transl_table 11 codon_start 1 locus_tag LOCUS_20740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028200.1 CDS 115963..117321 product glycerol-3-phosphate transporter transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene glpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010111.1 CDS complement(117404..117844) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene mepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278313.1 CDS complement(117948..119303) product multidrug efflux MATE transporter MepA transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene mepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651051.1 CDS complement(119410..119829) product multidrug efflux MATE transporter transcriptional repressor MepR transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene mepR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397416.1 CDS 120041..121996 product BglG family transcription antiterminator transl_table 11 codon_start 1 locus_tag LOCUS_20790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954271.1 CDS 122001..122444 product PTS ascorbate transporter subunit IIA transl_table 11 codon_start 1 locus_tag LOCUS_20800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050760.1 CDS 122446..122730 product PTS lactose transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_20810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699538.1 CDS 122745..124091 product PTS ascorbate transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_20820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147974.1 CDS complement(124184..125209) product aldehyde reductase transl_table 11 codon_start 1 locus_tag LOCUS_20830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 CDS complement(125524..126546) product lipoate--protein ligase A transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene lplA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280799.1 CDS complement(126524..127471) product NAD-dependent deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_20850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191954.1 CDS complement(127458..128258) product protein-ADP-ribose hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_20860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 CDS complement(128259..128591) product glycine cleavage system protein H transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene gcvH-L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731878.1 CDS complement(128625..129626) product LLM class flavin-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240063.1 CDS 129928..131127 product NADH-dependent flavin oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_20890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286459.1 CDS 131200..132027 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_20900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 CDS complement(132269..134341) product YSIRK domain-containing triacylglycerol lipase Lip2/Geh transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene lip2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943819.1 CDS 134759..136072 product histidine transporter transl_table 11 codon_start 1 locus_tag LOCUS_20920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077725.1 CDS complement(136199..136867) product N-acetylmannosamine-6-phosphate 2-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene nanE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936718.1 CDS 137007..137807 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene nanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667382.1 CDS complement(138085..138945) product ROK family protein transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene nanK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291444.1 CDS 139103..139984 product N-acetylneuraminate lyase transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene nanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030736.1 CDS 140024..141556 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene nanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 CDS complement(141661..142881) product pyrimidine nucleoside transporter NupC transl_table 11 codon_start 1 locus_tag LOCUS_20980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022972.1 CDS complement(142892..143815) product pseudouridine-5'-phosphate glycosidase transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene psuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 CDS complement(143790..144434) product carbohydrate kinase transl_table 11 codon_start 1 locus_tag LOCUS_21000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator assembly_gap 144502..144600 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(145198..146229) product PTS sugar transporter subunit IIC transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene pfoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031825880.1 CDS complement(146437..147114) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911017.1 CDS complement(147127..148176) product peptide ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_21030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477931.1 CDS complement(148425..149315) product 5'-nucleotidase, lipoprotein e(P4) family transl_table 11 codon_start 1 locus_tag LOCUS_21040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033876.1 CDS complement(149739..149978) product Branched-chain amino acid transport system carrier protein (Fragment) transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene brnQ_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509378.1 CDS 149899..151206 product branched-chain amino acid transporter II carrier protein transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene brnQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745087.1 CDS 151443..152267 product formate/nitrite transporter transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene fnt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 CDS complement(152483..152881) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_21080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415665.1 CDS complement(153034..153408) product cystatin-like fold lipoprotein transl_table 11 codon_start 1 locus_tag LOCUS_21090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822161.1 CDS complement(154031..154519) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575678.1 CDS complement(154530..155030) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008493.1 CDS complement(155041..155541) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141941.1 CDS complement(155552..156052) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141941.1 CDS complement(156063..156563) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008493.1 CDS complement(156574..157074) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008493.1 CDS complement(157086..157586) product TIGR01741 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008493.1 sequence16 source 1..129968 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(713..1159) product transcriptional repressor transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene perR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110007.1 CDS complement(1256..2206) product 2-hydroxyacid dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_21180 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869446.1 CDS complement(2212..2667) product thioredoxin-dependent thiol peroxidase transl_table 11 codon_start 1 locus_tag LOCUS_21190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939521.1 CDS 2748..4037 product glutamate-1-semialdehyde 2,1-aminomutase transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene gsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011595.1 CDS 4330..5424 product aromatic acid exporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_21210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236371.1 CDS complement(5615..7351) product multidrug ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 CDS complement(7642..8184) product DUF402 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251253.1 CDS complement(8486..9523) product A/G-specific adenine glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene mutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284765.1 CDS 9675..10652 product metal-dependent hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_21250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379098.1 CDS 10756..10986 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792192.1 CDS complement(10913..11749) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_21270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886462.1 CDS complement(11758..13275) product teichoic acid ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535834.1 CDS complement(13290..13604) product YfhH family protein transl_table 11 codon_start 1 locus_tag LOCUS_21290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435806.1 CDS complement(13582..14400) product regulatory protein RecX transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene recX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124422.1 CDS complement(14661..15470) product monofunctional glycosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene sgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830380.1 CDS complement(15811..16326) product glutamine amidotransferase transl_table 11 codon_start 1 locus_tag LOCUS_21320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 CDS complement(16457..16618) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005407.1 CDS 16842..17993 product radical SAM/CxCxxxxC motif protein YfkAB transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene yfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089621.1 CDS complement(18253..18783) product acyl-CoA thioesterase transl_table 11 codon_start 1 locus_tag LOCUS_21350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184383.1 CDS complement(18873..20120) product aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene ampS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795108.1 CDS complement(20132..20338) product DUF1128 family protein transl_table 11 codon_start 1 locus_tag LOCUS_21370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180460.1 CDS 20479..20943 product protein-tyrosine-phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene ptpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228666.1 CDS 20950..21225 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21390 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428172.1 CDS 21503..22720 product YihY/virulence factor BrkB family protein transl_table 11 codon_start 1 locus_tag LOCUS_21400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037075.1 CDS complement(22836..23465) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene vraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 CDS complement(23455..24498) product two-component sensor histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene vraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017131.1 CDS complement(24495..25196) product transporter transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene vraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149064.1 CDS complement(25211..25597) product Putative staphylococcal protein transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene orfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110179.1 CDS complement(25814..26572) product methionine aminopeptidase transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene map_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636142.1 CDS 27100..28086 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_21460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999717.1 CDS complement(28517..28978) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557448.1 CDS complement(29155..29886) product glutamine amidotransferase transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene gatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544969.1 CDS complement(29888..31201) product UDP-N-acetylmuramate--alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene murT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250343.1 CDS 31493..31993 product non-heme ferritin transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene ftnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949467.1 CDS 32382..32936 product DNA polymerase III subunit epsilon transl_table 11 codon_start 1 locus_tag LOCUS_21510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613738.1 CDS complement(33004..34074) product DNA polymerase IV transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene dinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140172.1 CDS complement(34321..34851) product DUF3267 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548781.1 CDS complement(35021..36382) product RNA methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene rumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147865.1 CDS complement(36463..37410) product diacylglycerol kinase transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene dgkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231451.1 CDS complement(37993..38139) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789566.1 CDS complement(38179..39606) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene gatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545370.1 CDS complement(39619..41076) product glutamyl-tRNA(Gln) amidotransferase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene gatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027919.1 CDS complement(41078..41380) product aspartyl/glutamyl-tRNA amidotransferase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene gatC_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 CDS 41747..43285 product sodium:proline symporter transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene putP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957020.1 CDS complement(43374..44573) product CamS family sex pheromone protein transl_table 11 codon_start 1 locus_tag LOCUS_21610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831700.1 CDS complement(44586..46589) product NAD-dependent DNA ligase LigA transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene ligA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774556.1 CDS complement(46593..48785) product DNA helicase PcrA transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene pcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 CDS complement(48782..49474) product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene pcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272056.1 CDS complement(49646..49948) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene hisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165363.1 CDS complement(50057..51352) product adenylosuccinate lyase transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene purB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572878.1 CDS 52213..53379 product cysteine protease staphopain A transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene scpA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827746.1 CDS 53410..53736 product staphostatin A transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene scpB_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434933.1 CDS complement(54028..54201) product NETI motif-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669862.1 CDS complement(54182..54784) product DUF2179 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011542.1 CDS complement(55055..55876) product NAD(+) synthetase transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene nadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040866.1 CDS complement(55869..57338) product nicotinate phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene pncB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284436.1 CDS 57522..58598 product nitric oxide synthase oxygenase transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene nos inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897635.1 CDS 58618..59412 product prephenate dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_21740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177828.1 CDS complement(59602..61164) product sodium-dependent dicarboxylate transporter SdcS transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene sdcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 CDS complement(61369..62466) product pectate lyase transl_table 11 codon_start 1 locus_tag LOCUS_21760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275727.1 CDS 62838..63398 product cysteine hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene pncA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149686.1 CDS 63451..64380 product manganese-dependent inorganic pyrophosphatase transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene ppaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140871.1 CDS complement(64575..64748) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792184.1 CDS 64800..66179 product aldehyde dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene aldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021210.1 CDS complement(66299..67327) product lactonase family protein transl_table 11 codon_start 1 locus_tag LOCUS_21810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181315.1 CDS 67597..67998 product YolD-like family protein transl_table 11 codon_start 1 locus_tag LOCUS_21820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205106.1 CDS complement(68571..68744) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267034.1 CDS 69195..70235 product choloylglycine hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_21840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188043.1 CDS complement(70292..71134) product DUF4097 family beta strand repeat protein transl_table 11 codon_start 1 locus_tag LOCUS_21850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713072.1 CDS complement(71131..71688) product DUF1700 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033971.1 CDS complement(71748..72272) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_21870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966288.1 CDS 72393..72956 product thioredoxin family protein transl_table 11 codon_start 1 locus_tag LOCUS_21880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182842.1 CDS complement(73022..73762) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene pmtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221651.1 CDS complement(73762..74634) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene pmtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763043.1 CDS complement(74631..75311) product ABC-2 transporter family protein transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene pmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645727.1 CDS complement(75312..76208) product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene pmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991306.1 CDS complement(76205..76585) product GntR family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691584.1 CDS complement(76844..77020) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681968.1 CDS 77561..78847 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme transl_table 11 codon_start 1 locus_tag LOCUS_21950 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 CDS complement(79171..79461) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene map_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671712.1 CDS complement(79472..81226) product MAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene eap/map inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557458.1 CDS 81615..82607 product phosphodiesterase transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene hlb-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283440.1 CDS complement(82845..83861) product gamma-hemolysin subunit B transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene lukG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595392.1 CDS complement(83883..84938) product succinyl-diaminopimelate desuccinylase transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene lukH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791411.1 CDS 85373..86596 product succinyl-diaminopimelate desuccinylase transl_table 11 codon_start 1 locus_tag LOCUS_22010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206625.1 CDS complement(86968..87813) product class I SAM-dependent methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824908.1 CDS complement(87875..88786) product ferrichrome-binding protein FhuD transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene fhuD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825515.1 CDS 88947..90254 product potassium transporter KtrB transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene ktrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045079.1 CDS complement(91107..91550) product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836809.1 CDS complement(91656..92057) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(92411..93001) product terminase small subunit transl_table 11 codon_start 1 locus_tag LOCUS_22070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293076.1 CDS complement(92998..93213) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001807583.1 CDS 93343..93690 product site-specific integrase transl_table 11 codon_start 1 locus_tag LOCUS_22090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 93281,93558 CDS complement(93912..95528) product molecular chaperone GroEL transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene groEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240642.1 CDS complement(95604..95888) product co-chaperone GroES transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene groES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917289.1 CDS 96063..96806 product CPBP family intramembrane metalloprotease transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene mroQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197635.1 CDS complement(96831..98090) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene sdrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 98287..98913 product nitroreductase transl_table 11 codon_start 1 locus_tag LOCUS_22140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522381.1 CDS 99274..100059 product hydrolase in agr operon transl_table 11 codon_start 1 locus_tag LOCUS_22150 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867951.1 CDS complement(100656..100793) product delta-lysin family phenol-soluble modulin transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene hld inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549197.1 CDS 101026..101595 product accessory gene regulator AgrB transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene agrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105696.1 CDS 101592..101732 product cyclic lactone autoinducer peptide transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene agrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 101757..103049 product Staphylococcal accessory gene regulator protein C transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene agrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447888.1 CDS 103068..103793 product response regulator transcription factor transl_table 11 codon_start 1 locus_tag LOCUS_22200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688492.1 CDS complement(104152..105111) product carbohydrate kinase transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene fruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253312.1 CDS complement(105108..106592) product glycoside hydrolase family 32 protein transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene scrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 CDS complement(106741..107691) product LacI family transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene scrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790331.1 CDS complement(107874..109124) product ammonium transporter transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene nrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052270.1 CDS complement(109332..109556) product oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_22250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581076.1 CDS complement(109616..110695) product YeeE/YedE family protein transl_table 11 codon_start 1 locus_tag LOCUS_22260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072414299.1 CDS complement(110999..111634) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283612.1 CDS 111887..113815 product ABC-F type ribosomal protection protein transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene abc-f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 CDS 114177..115787 product DNA mismatch repair protein MutS transl_table 11 codon_start 1 locus_tag LOCUS_22290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106332.1 CDS complement(115889..116914) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene gcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159041.1 CDS complement(116907..117371) product ribosomal-protein-alanine N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene rimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447043.1 CDS complement(117344..118006) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene tsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086737.1 CDS complement(117987..118448) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene tsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014532666.1 CDS 118959..120647 product dihydroxy-acid dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene ilvD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255780.1 CDS 120675..122444 product acetolactate synthase, large subunit, biosynthetic type transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene ilvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047811.1 CDS 122444..122698 product acetolactate synthase 1 regulatory subunit transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene ilvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196911.1 CDS 122835..123839 product ketol-acid reductoisomerase transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene ilvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214552.1 CDS 123869..125398 product 2-isopropylmalate synthase transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene leuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094583.1 CDS 125401..126447 product 3-isopropylmalate dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene leuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221945.1 CDS 126461..127831 product 3-isopropylmalate dehydratase large subunit transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene leuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531823.1 CDS 127832..128404 product 3-isopropylmalate dehydratase small subunit transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene leuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718953.1 CDS 128419..129687 product L-threonine dehydratase biosynthetic IlvA transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene ilvA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216856.1 sequence17 source 1..125557 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS complement(301..1683) product PLP-dependent aminotransferase family protein transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene pdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799248.1 CDS 1787..2674 product pyridoxal 5'-phosphate synthase lyase subunit PdxS transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene pdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034728.1 CDS 2678..3238 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene pdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690439.1 CDS complement(3446..4660) product pyrimidine nucleoside transporter NupC transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene nupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547794.1 CDS 4818..5279 product transcriptional regulator CtsR transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene ctsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551762.1 CDS 5298..5864 product excinuclease ABC subunit B transl_table 11 codon_start 1 locus_tag LOCUS_22480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443618.1 CDS 5854..6861 product protein arginine kinase transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene mcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149502.1 CDS 6875..9331 product ATP-dependent Clp protease ATP-binding subunit ClpC transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene clpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897132.1 CDS 9816..11180 product DNA repair protein RadA transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene radA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085219.1 CDS 11205..12278 product PIN/TRAM domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802965.1 CDS 12835..14289 product glutamate--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene gltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283792.1 CDS 14718..15359 product serine acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene cysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805237.1 CDS 15343..16743 product cysteine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene cysS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 CDS 16736..17140 product Mini-ribonuclease 3 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene mrnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370182.1 CDS 17148..17894 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene rlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390332.1 CDS 17894..18418 product NYN domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_22580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664737.1 CDS 18499..19068 product RNA polymerase sigma factor transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene sigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872882.1 CDS 19382..19564 product preprotein translocase subunit SecE transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene secE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074473.1 CDS 19577..20125 product transcription termination/antitermination protein NusG transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene nusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288302.1 CDS 20306..20728 product 50S ribosomal protein L11 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene rplK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 CDS 20936..21628 product 50S ribosomal protein L1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene rplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074619.1 CDS 21900..22400 product 50S ribosomal protein L10 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene rplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 CDS 22443..22811 product 50S ribosomal protein L7/L12 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene rplL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273586.1 CDS 22986..23594 product methyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene rsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020304.1 CDS 23809..27360 product DNA-directed RNA polymerase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene rpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918667.1 CDS 27497..31120 product DNA-directed RNA polymerase subunit beta' transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene rpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788197.1 CDS 31257..31511 product 50S ribosomal protein L7ae-like protein transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene rplGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031892.1 CDS 31609..32022 product 30S ribosomal protein S12 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene rpsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142337.1 CDS 32088..32558 product 30S ribosomal protein S7 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene rpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 CDS 32681..34762 product elongation factor G transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene fusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090315.1 CDS 34979..36163 product elongation factor Tu transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene tuf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040568.1 CDS complement(36445..37620) product N-acetyl-L,L-diaminopimelate deacetylase transl_table 11 codon_start 1 locus_tag LOCUS_22740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887920.1 CDS 37791..38978 product 2-amino-3-ketobutyrate CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene kbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250823.1 CDS 39244..40122 product chaperone protein HchA transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene hchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076404.1 CDS 40281..41918 product ribulokinase transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene araB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122354.1 CDS 42132..43097 product UDP-glucose 4-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_22780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723301.1 CDS 43432..44508 product branched chain amino acid aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene ilvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076036.1 CDS 44481..44654 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_22800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 44758..45441 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_22810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454780.1 CDS complement(45557..46219) product deoxynucleoside kinase transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene dck inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067261.1 CDS complement(46212..46829) product deoxynucleoside kinase transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene dgk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039516.1 CDS 46896..47366 product tRNA-specific adenosine deaminase transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene tadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180281.1 CDS 47513..48382 product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_22850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593361.1 CDS 48403..48969 product FMN-dependent NADPH-azoreductase transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene azo1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677261.1 CDS 49400..52387 product Serine-aspartate repeat-containing protein C transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene sdrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 52754..56803 product MSCRAMM family adhesin SdrD transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene sdrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934467.1 CDS 56922..58394 product glycosyl transferase family 1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106740.1 CDS complement(58518..60008) product glycosyl transferase family 1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106104.1 CDS complement(60290..61168) product GTP cyclohydrolase I FolE2 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene folE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134236.1 CDS complement(61181..61846) product bacillithiol biosynthesis deacetylase BshB2 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene bshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 CDS complement(61860..62219) product YojF family protein transl_table 11 codon_start 1 locus_tag LOCUS_22930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557152.1 CDS 62498..63256 product glucosamine-6-phosphate deaminase transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene nagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866415.1 CDS 63333..63965 product 3-hexulose-6-phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene hxlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422861.1 CDS 63967..64515 product 6-phospho-3-hexuloisomerase transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene hxlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051594.1 CDS 64628..65275 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_22970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 CDS 65777..67177 product proline/betaine transporter transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene proP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347061.1 CDS 67721..69097 product long-chain-fatty-acid--CoA ligase transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene vraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100835.1 CDS 69099..70238 product thiolase family protein transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene vraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070676.1 CDS 70213..70578 product protein VraC transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene vraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165058.1 CDS 70581..70850 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671099.1 CDS complement(71051..71218) product protein VraX transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene vraX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587958.1 CDS complement(71725..72555) product phosphomethylpyrimidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene pdxK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185462.1 CDS 72739..73395 product uracil-DNA glycosylase transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene ung inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455256.1 CDS 73396..73776 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248117.1 CDS 73909..74277 product DUF423 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 CDS 74398..75882 product APC family permease transl_table 11 codon_start 1 locus_tag LOCUS_23080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412514.1 CDS complement(76024..76476) product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_23090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498572.1 CDS complement(76489..77253) product threonine/serine exporter ThrE family protein transl_table 11 codon_start 1 locus_tag LOCUS_23100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354088.1 CDS complement(77802..78554) product heme-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene hemQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075704.1 CDS 78722..79708 product phosphate acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene pta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774281.1 CDS 79711..80547 product Octanoyl-[GcvH]:protein N-octanoyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene lipL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190413.1 CDS 81134..82054 product mevalonate kinase transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene mvaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197034.1 CDS 82059..83042 product diphosphomevalonate decarboxylase transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene mvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597327.1 CDS 83055..84131 product phosphomevalonate kinase transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene mvaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616885.1 CDS 84308..84649 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23170 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS complement(84701..86023) product FAD-containing oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene merA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860592.1 CDS complement(86010..86450) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047238.1 CDS 87075..88484 product transposase transl_table 11 codon_start 1 locus_tag LOCUS_23200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020814.1 CDS 88488..89114 product DUF443 family protein transl_table 11 codon_start 1 locus_tag LOCUS_23210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 89249..89881 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882118.1 CDS 89969..90586 product DUF443 family protein transl_table 11 codon_start 1 locus_tag LOCUS_23230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 90661..91290 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 91486..92106 product DUF443 family protein transl_table 11 codon_start 1 locus_tag LOCUS_23250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 92246..92878 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882118.1 CDS 92925..93392 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23270 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 93383 CDS 94006..94635 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23280 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226989.1 CDS 94759..95400 product DUF443 family protein transl_table 11 codon_start 1 locus_tag LOCUS_23290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226989.1 CDS 95437..96072 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 96038..96283 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 96307..96933 product DUF443 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882087.1 CDS 97203..98141 product aldo/keto reductase transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene iolS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808888.1 CDS 98352..98888 product flavodoxin family protein transl_table 11 codon_start 1 locus_tag LOCUS_23340 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633782.1 CDS 99057..99533 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23350 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477505.1 CDS 99573..100868 product HD domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180234.1 CDS 100911..101417 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792725.1 CDS 101916..102926 product zinc-dependent alcohol dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene adh1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200747.1 CDS 103201..103617 product DUF1934 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene ywiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001819741.1 CDS 103614..105275 product arginine--tRNA ligase transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene argS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021144.1 CDS 105664..106299 product endonuclease III domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901751.1 CDS 106678..107565 product ABC transporter substrate-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23420 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817979.1 CDS 107713..108663 product iron ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_23430 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922824.1 CDS 108718..109437 product HAD family hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_23440 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365354.1 CDS 109421..110221 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_23450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362976.1 CDS 110357..110863 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23460 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735558.1 CDS 111025..111741 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222133.1 CDS 111910..112698 product alpha/beta hydrolase transl_table 11 codon_start 1 locus_tag LOCUS_23480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045423.1 CDS complement(112949..113323) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene sarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018677.1 CDS complement(114271..115164) product DMT family transporter transl_table 11 codon_start 1 locus_tag LOCUS_23500 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557159.1 CDS complement(115395..115619) product DUF2922 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169042.1 CDS complement(115636..115839) product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036086.1 CDS 115998..116558 product tyrosine-type recombinase/integrase transl_table 11 codon_start 1 locus_tag LOCUS_23530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044915.1 CDS 116577..118979 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene mnhA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060771.1 CDS 118966..119391 product Na(+)/H(+) antiporter subunit B transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene mnhB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661906.1 CDS 119388..119732 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene mnhC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048985.1 CDS 119722..121218 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene mnhD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950546.1 CDS 121219..121701 product Na+/H+ antiporter subunit E transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene mnhE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071971.1 CDS 121698..122000 product cation:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene mnhF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616642.1 CDS 121975..122412 product Na+/H+ antiporter subunit G transl_table 11 codon_start 1 locus_tag LOCUS_23600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072353857.1 CDS 122752..124794 product sodium:proton antiporter transl_table 11 codon_start 1 locus_tag LOCUS_23610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402171.1 sequence18 source 1..109099 organism Genus sp. mol_type genomic DNA ff_definition @@[organism]@@ @@[strain]@@ DNA, complete genome: @@[entry]@@ geo_loc_name collection_date CDS 183..1091 product arginase transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene rocF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 CDS 1280..2089 product ABC transporter permease transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene dacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347896.1 CDS 2091..3023 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene ybbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894032.1 CDS 3050..4405 product phosphoglucosamine mutase transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene glmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521495.1 CDS 4682..12118 product DUF1542 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048266.1 CDS complement(12437..13543) product mannitol-1-phosphate 5-dehydrogenase transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene mtlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648723.1 CDS complement(13543..13977) product mannitol-specific phosphotransferase enzyme IIA component transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene mtlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292149.1 CDS complement(13989..16121) product PTS lactose transporter subunit IIB transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene mtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927371.1 CDS complement(16156..17694) product EIICB-Mtl transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene mtlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083807.1 CDS 18375..20180 product glutamine--fructose-6-phosphate aminotransferase transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene glmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334463.1 CDS 20412..21194 product ABC transporter ATP-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_23720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908182.1 CDS 21262..22119 product HAD family phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_23730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370925.1 CDS 23205..24341 product SAP domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 24400..24603 product Resolvase transl_table 11 codon_start 1 locus_tag LOCUS_23750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 24422 note possible pseudo due to internal stop codon CDS complement(25575..26666) product lytic regulatory protein transl_table 11 codon_start 1 locus_tag LOCUS_23760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495669.1 CDS complement(26932..27912) product cation transporter transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene czrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019734.1 CDS complement(27914..28234) product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene czrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003759.1 CDS 28386..29051 product NAD(P)-dependent oxidoreductase transl_table 11 codon_start 1 locus_tag LOCUS_23790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024095.1 CDS 29486..29632 product Mannose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene manA_1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 29578 CDS 29595..30425 product mannose-6-phosphate isomerase transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene manA_2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127960.1 CDS 30456..30686 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_23820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808817.1 CDS 31358..32731 product EVE domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123398.1 CDS 33189..33602 product thiol-disulfide oxidoreductase DCC family protein transl_table 11 codon_start 1 locus_tag LOCUS_23840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123303.1 CDS 33802..34245 product DNA starvation/stationary phase protection protein transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070866.1 CDS complement(34366..35076) product purine-nucleoside phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene deoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 assembly_gap 35708..35849 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 36171..37472 product pyrimidine-nucleoside phosphorylase transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene pdp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 CDS 37486..37836 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_23880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024035.1 CDS complement(37988..38458) product S-ribosylhomocysteine lyase transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene luxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164421.1 CDS 38769..39953 product aminobenzoyl-glutamate utilization protein B transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene hmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291497.1 CDS 39953..41146 product ATP-grasp domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23910 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183717.1 CDS 41545..42216 product DUF2750 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120549.1 CDS complement(42346..43149) product type II pantothenate kinase transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene coaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862728.1 CDS 43573..44433 product N-acetyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23940 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040743.1 CDS 44545..45075 product DNA-directed RNA polymerase subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene rpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701483.1 CDS 45411..47021 product CTP synthase transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene pyrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159960.1 CDS complement(47130..47651) product DUF2529 domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_23970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036002.1 CDS 47869..48729 product fructose-bisphosphate aldolase transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene fbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131841.1 CDS 49195..50454 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene murA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046602.1 CDS 50543..50878 product transcriptional regulator transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene qsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451438.1 CDS 51116..52543 product aldehyde dehydrogenase family protein transl_table 11 codon_start 1 locus_tag LOCUS_24010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206093.1 CDS 52790..54106 product transcription termination factor Rho transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115101.1 CDS 54224..54478 product 50S ribosomal protein L31 type B transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene rpmE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808968.1 CDS 54825..55424 product thymidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene tdk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273358.1 CDS 55425..56501 product peptide chain release factor 1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene prfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460242.1 CDS 56488..57324 product protein-(glutamine-N5) methyltransferase, release factor-specific transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene prmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248732.1 CDS 57408..58454 product threonylcarbamoyl-AMP synthase transl_table 11 codon_start 1 locus_tag LOCUS_24070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445903.1 CDS 58451..58870 product protein-tyrosine-phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene ptpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697334.1 CDS 58977..59501 product TIGR01440 family protein transl_table 11 codon_start 1 locus_tag LOCUS_24090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654184.1 CDS 59528..60766 product serine hydroxymethyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene glyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120494.1 CDS 60794..61423 product uracil phosphoribosyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene upp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 CDS 61444..62574 product UDP-GlcNAc 2-epimerase transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene mnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723418.1 CDS 62741..63094 product ATP synthase transl_table 11 codon_start 1 locus_tag LOCUS_24130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator CDS 63115..63843 product ATP synthase subunit A transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene atpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349655.1 CDS 63886..64098 product ATP synthase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene atpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNJ2 CDS 64296..64817 product ATP synthase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene atpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140679.1 CDS 64817..65356 product ATP synthase subunit delta transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene atpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241344.1 CDS 65378..66886 product F0F1 ATP synthase subunit alpha transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene atpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974881.1 CDS 66917..67783 product ATP synthase subunit gamma transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene atpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157603.1 CDS 67805..69217 product ATP synthase subunit beta transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene atpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511135.1 CDS 69237..69641 product ATP synthase epsilon chain transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene atpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094394.1 CDS 70203..70436 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_24220 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384523.1 CDS 70547..71812 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene murA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358006.1 CDS 71846..72286 product beta-hydroxyacyl-ACP dehydratase transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene fabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 CDS complement(72345..72785) product YwpF protein transl_table 11 codon_start 1 locus_tag LOCUS_24250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789631.1 CDS 72979..73374 product single-stranded DNA-binding protein transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene ssbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932694.1 CDS 73763..74458 product lytic transglycosylase SceD transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene sceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752005.1 CDS 74844..75533 product thiaminase II transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene tenA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396077.1 CDS 75526..76356 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene thiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594954.1 CDS 76340..77131 product hydroxyethylthiazole kinase transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene thiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108483.1 CDS 77133..77774 product thiamine phosphate synthase transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene thiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483153.1 CDS 77860..78732 product protein translocase component YidC transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene yidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725802.1 CDS complement(79545..80192) product phosphohydrolase transl_table 11 codon_start 1 locus_tag LOCUS_24330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187630.1 CDS complement(80220..81704) product cardiolipin synthase transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene cls2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 CDS 81870..82163 product copper-sensing transcriptional repressor CsoR transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene csoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138932.1 CDS 82175..82384 product heavy-metal-associated domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_24360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581792.1 CDS 82512..82649 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828354.1 CDS complement(82913..84115) product cell division protein FtsW transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene rodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109939.1 CDS 84433..85503 product D-alanine--D-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene ddl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159631.1 CDS 85518..86876 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene murF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611464.1 CDS 87393..88913 product DEAD/DEAH box family ATP-dependent RNA helicase transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene cshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178942.1 CDS complement(89282..89977) product DNA-binding response regulator transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene kdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190841.1 CDS complement(89977..92634) product Histidine kinase transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene kdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072278.1 CDS 92906..94582 product potassium-transporting ATPase A chain transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene kdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402651.1 CDS 94601..96628 product potassium-transporting ATPase subunit B transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene kdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546611.1 CDS 96648..97208 product potassium-transporting ATPase subunit C transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene kdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092411.1 CDS 97417..97896 product hypothetical protein transl_table 11 codon_start 1 locus_tag LOCUS_24470 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287087.1 CDS 97889..99472 product PH domain-containing protein transl_table 11 codon_start 1 locus_tag LOCUS_24480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294626.1 CDS 99459..99950 product membrane protein transl_table 11 codon_start 1 locus_tag LOCUS_24490 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205912.1 CDS 99954..100313 product holo-ACP synthase transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene acpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581197.1 CDS 100379..101527 product alanine racemase transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene alr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281154.1 CDS 101612..101782 product type II toxin-antitoxin system antitoxin MazE transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene mazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948331.1 CDS 101779..102141 product mRNA interferase MazF transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene mazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621175.1 CDS 102490..102717 product SigmaB regulation protein RsbU, putative transl_table 11 codon_start 1 locus_tag LOCUS_24540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note frameshifted, insertion/deletion at around 102705 CDS 102692..103480 product PP2C family protein-serine/threonine phosphatase transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene rsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390829.1 note frameshifted, insertion/deletion at around 102705 CDS 103599..103925 product anti-sigma B factor antagonist transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052491.1 CDS 103927..104406 product anti-sigma B factor RsbW transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene rsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447044.1 CDS 104381..105151 product RNA polymerase sigma factor SigB transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene sigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041111.1 CDS 105585..107735 product RNA-binding transcriptional accessory protein transl_table 11 codon_start 1 locus_tag LOCUS_24590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 CDS 107728..108183 product SprT family protein transl_table 11 codon_start 1 locus_tag LOCUS_24600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058111.1 tRNA 108830..108912 product tRNA-Leu locus_tag LOCUS_t00520 inference COORDINATES:profile:Aragorn:1.2.38 tRNA 108935..109008 product tRNA-Gly locus_tag LOCUS_t00530 gene trnaG_5 inference COORDINATES:profile:Aragorn:1.2.38